Open Close
General Information
Symbol
Dmel\hth-RE
Species
D. melanogaster
Annotation Symbol
CG17117-RE
FlyBase ID
FBtr0100454
Feature type
Associated gene
Evidence Rank
Length (nt)
3868
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 81 )
Sequence
GCTCTCTTTGACAAACGCAACGCAACGCGACGCGACGCGAGTGGGCTCTTGGCCAGGCTTTTGTTGTTCCCAATAAACGT
AAAAAAAAATAATAATACAAAATTCAGATAAATATAAAAATTACAAAAATGCAAACTCACTTGCGGCTCAAAACATAAGT
TGCTCGAATAAGAAAGTGCGGTGAAAGCAGCGACTAGAAGCTGAAAAATCGAAATAGTCGCGAGATTAGAAATTTTGTGT
GTGTGTGTGAGGGATATGGAGAAAGGACATCGCGACGCCATGTTAGACGTGTTTGTTGTCGTTGTCGCCGCCACGTTGTC
GGTGCATCTCGCTCCTGGATGCCACTAGAATCGGGATAACCATAGCCCATAGCTCGGCACGGAGCATTGGACAATGGCAG
TTGCTCCGTAATCCCCACTAGAAAGTGCTAGAGGAAAAACCCGCCAGCGGAGGAAAGTGGAAGCACCGTTAGACGTAGAC
GTTATCCCGTAGACCCCCCGGAAAATCCCGTATCCCCCCTTGGAAATTCCCACAGTGTTTTAGTTGCTCGCTCGCTCGCT
CGCTCGCTCGCTCTCTCTCTCTCTGAATCTCTCTGTGTGTTGGTGTGCGTGACTTACTCCTTCGCGCTGTCACTCTCCCA
AGGACTCTTTCGGCACATCCTCTCCCTTACTCTCTCTGGCGTGACATGTTTATGTTTTGGCCCCAAACGGCGCTCTCAGT
GGCCAATTTTGACAGCCAGAACTGTCAGTGTACAGTGGCGCAATTCAAGGAAATTCCGCGCAAAATCCTTGTTGACAAAC
AGCATGTGATGGTGGAGTGAAATTGGCAAAAGCAAGACTCACTTAACGCACTTAATGGTTCCTAGTTGATACTAAACTGA
TACAAAGGACGAAGGATAACGGCGGATATCTTTGAGACACTGGCGGTGGATTGGTAAATTGATTGTAACGTAGTATGTAG
AAGCAGCTGTGATAAATAGTGCGCATATTATACGAAAAAAGCAAAAAGAGTATACGACAAACAAATAAAAATTAAAAGCA
ACCACAACTACTACTATAAAAATAACCAAGGAAAAGGCAAGGAAACTCGCAAAACGAGAGAGAGAGGAAAAGGGAAAAAA
CGCCATGGATTTATGACAACAACAAATGCAACCCAGTAACAAATGATGTTGCAGCAACTACTACAATACACGAGTATACC
AAGAACATCAACAACAACAACTGCAACGGCAACCAACAACAAATTGTATACGATTTTTATAAACCAAACAAATGCTATGT
AAATAATTATTATAACAAACACACAAGTAAAAAAAACATTCAAAACCAGATCTCCCGCTCTAGAAAACAAACAACAAACG
CGCGCGTAACAAAAACGACAACATCAACAATACAACAAGTATACAAACGTAATAATAATACATAAAATCTAAACAAATGT
GCCTGTGTTAAAAAAAAAGAAAGCAAAATCAAGAAGCAAAGCGTTCAAAAAGCAAAGGCTTCCCAATACATGAAAAAAGT
GCAAAACATATATAAAAATCCAAGAAAATAACATCCAAAACTGAAGAACTGGAAAAGCCAAGAGTAAATCTAAGGACTCC
ACACGGGCAGCTACAGTAGAGCTTCCCTAAAACCGAAGCAGTTGCAGCGGCGGAGCGGGACGTCGGTCAGTGTGTTGCGC
CCCCATTTGTTGTTCCTACTGTAAAAAGTGGCACAAATCGGGTTAGACGTCGCTCCCAGAGCATTAATGGCTCAGCCCAG
GTATGACGATGGCCTACACGGCTACGGCATGGACTCCGGAGCCGCAGCAGCGGCCATGTACGATCCACACGCCGGTCACC
GGCCGCCCGGACTGCAGGGCCTCCCCTCGCACCACTCTCCGCACATGACGCACGCAGCGGCGGCGGCGGCCACAGTGGGC
ATGCACGGCTACCATTCGGGGGCCGGGGGTCATGGAACACCTAGTCATGTATCGCCGGTCGGTAATCACCTAATGGGCGC
AATACCCGAAGTACACAAACGTGATAAGGATGCGATTTATGAACATCCGCTATTCCCGCTTTTGGCGCTGATCTTTGAGA
AGTGCGAATTGGCCACATGTACGCCGAGGGAGCCCGGTGTGCAAGGTGGCGATGTCTGTTCGTCGGAATCGTTCAACGAG
GATATTGCAATGTTCAGTAAACAGATAAGATCACAGAAACCCTATTATACCGCAGATCCCGAAGTCGACTCACTGATGGT
GCAAGCAATACAAGTACTTCGGTTTCACCTTTTAGAATTAGAAAAAGTACACGAGTTATGCGATAACTTCTGTCATCGGT
ATATATCGTGTTTAAAGGGTAAAATGCCAATAGATTTAGTGATCGACGAACGGGACACCACCAAACCACCGGAGTTGGGA
TCGGCGAACGGAGAAGGGCGCAGCAACGCCGACTCCACATCGCACACCGATGGAGCTAGTACACCAGACGTTCCCAGCAC
CCAAGACTTTTCACCGCTGGAGGAGACCTATGCCAGCTATCGCATCAAACACGAGGCGGACTTTTAGTCCGGCCCGACTT
TTCCCCTTCGACCCCCTCAGCAGTTCTCTATGAATATACTGAAAATCGATCTAATATAGAGATAACGCTTAGCCATGTAG
TTTGTAACTAAAGTCAAGTCTAGGCTGCGCTTAAAAGAATTCACTCGCAAGTAAAAGAGAGAGGAGCAAACGCTAAAAGT
ATAGTTAATTCCTAGAAACTTTCTAAACATATTTTCTATGCTTAGTTTTCAATTTTTTTTTTCCTATATGTTTTCGGGAA
TTTTTCACTTTAGCAAACGTGTATACGATTTTTCAAAAACAAAACGTCCTTTTTCCCTCCTCGTGTTTTACAACACTGGA
GCGAACTTGCCAAATAATTAATAATCAATAATCGCAAAAAAAAACGCTAAATGAGAATATTAACTATTTTCGTTAATCTT
TTTTGTTTAACTCTGAACATGCAACGCATATACGTAAAAGAGATACCAGAAAAGAAACCCCAACCTGAGTTCAAATGCAA
AGTATACGAATAAAACTTTATTGTTTATTAAATAATGAAAATGGAAATCGAAACAAAAACTTAAAGTTAATTTAATTAAT
TGAGGATTGCAATGCGCCTATACGAACGACATTTTAAATGAGCCGATACCCTTCAAGAACAATGATATACGTAAATCAAC
AGCAACAACTAAAAACTAAACAAACTTTTAGCATTTACTAAAGCAAATCGAAAACTACGCGATACTACTATTATAAAATA
AACATAAAAGGAGAAAGCTAATGTAATTTAATTGAATTAGGGAGCCGTGGAGAAACTTAGAGATCCCACGCTCTCCTCCC
CCAATTGTATACTATAGCGTACGTTATATAGTTCTTAGTCAGGCCCCAAAATCCCCAATTTACCAACCCCCCCCCCCCCC
TTTGGAGTTGTATGCTAGGCGAACCCCTAAGCTTGCAAGCGAAACTCAAAGATACGAAAATCGTAAGCAGCAAACCCCTC
TTCTAGCTACCAAAACCAACCAACAGAACACTTTCTACTGCTAATTTCTACTACTATTTTGAGTTGTAGACCTACTAAAC
CAACAAAACTACAAAAAAAATGTACTTAAATCGAACTGCGAACAGTCGATCGCAGTTCTTCAGCTATATGGGCAGTCATT
TGTATACTTAGACTATAGTCGAACCGATTCCCAGCGGTTTATTATAGCCAACTAACTAAAAAACAACAACAACGTGAAAA
GCTTTTGTACTATTTTTTCAAAACTACAAAACGAAAACTTCTTGCAAAACTATAAAAAAAATTTGCAACAAAAAAATTAA
AATAGTTGTTGTACTTTGTCTCAAACCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0082256
4226
FBtr0082255
6557
FBtr0100455
2462
FBtr0344145
6340
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0099878
266
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0081733
472
FBpp0081732
487
FBpp0099879
266
FBpp0310558
266
Comments

Based on cDNA(s) that contain early stop codon; may or may not produce functional polypeptide.

Transcript terminates at site supported by polyadenylated cDNA.

5' UTR based on RNA-Seq data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (4)
Reported As
Symbol Synonym
CG17117-RD
hth-RD
hth:1-RG
Secondary FlyBase IDs
    References (2)