Open Close
General Information
Symbol
Dmel\hth-RF
Species
D. melanogaster
Annotation Symbol
CG17117-RF
FlyBase ID
FBtr0100455
Feature type
Associated gene
Evidence Rank
Length (nt)
2462
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTTCGATGAAATATCTTTCATCCGCACAGTGTATTTTTGACTGCGAAGCGCGTACGACGTGTGTCTGTGTTGCGTTGCGT
      TCGAATAAAAAAGAGAAGAAAAGCGAAAAAGTGTTGCCGTCGGTGAAGTTTATTATTATTATGATTATTATTATTGCCCG
      TTAACCACGCGTTTTGCCATCAATCAACAAATAAACAACACAAGAAACACTTTGGAAATCGCGCGCGTTTTTCCATCGCG
      CGAACAAAACAATCACGTTTTTTAGTGTGTTTTTCAATCACAATCGAAAAGTTCTCCTTTTCACAATTGAAGGCCAAAAT
      AAATACTGTTATTTGAGGGCCGCGGAGGGAATTTCTTTCAACGAGGGGATCCCGCCGATCCCCCCGCAAAAACAAAGAAA
      CACGCAAATTGCCGTCGCAAAAACACAACAGAATATATTGCATTATATATTAACAATATAATTTGTTCATCTCTAGTAAC
      GTAGTATGTAGAAGCAGCTGTGATAAATAGTGCGCATATTATACGAAAAAAGCAAAAAGAGTATACGACAAACAAATAAA
      AATTAAAAGCAACCACAACTACTACTATAAAAATAACCAAGGAAAAGGCAAGGAAACTCGCAAAACGAGAGAGAGAGGAA
      AAGGGAAAAAACGCCATGGATTTATGACAACAACAAATGCAACCCAGTAACAAATGATGTTGCAGCAACTACTACAATAC
      ACGAGTATACCAAGAACATCAACAACAACAACTGCAACGGCAACCAACAACAAATTGTATACGATTTTTATAAACCAAAC
      AAATGCTATGTAAATAATTATTATAACAAACACACAAGTAAAAAAAACATTCAAAACCAGATCTCCCGCTCTAGAAAACA
      AACAACAAACGCGCGCGTAACAAAAACGACAACATCAACAATACAACAAGTATACAAACGTAATAATAATACATAAAATC
      TAAACAAATGTGCCTGTGTTAAAAAAAAAGAAAGCAAAATCAAGAAGCAAAGCGTTCAAAAAGCAAAGGCTTCCCAATAC
      ATGAAAAAAGTGCAAAACATATATAAAAATCCAAGAAAATAACATCCAAAACTGAAGAACTGGAAAAGCCAAGAGTAAAT
      CTAAGGACTCCACACGGGCAGCTACAGTAGAGCTTCCCTAAAACCGAAGCAGTTGCAGCGGCGGAGCGGGACGTCGGTCA
      GTGTGTTGCGCCCCCATTTGTTGTTCCTACTGTAAAAAGTGGCACAAATCGGGTTAGACGTCGCTCCCAGAGCATTAATG
      GCTCAGCCCAGGTATGACGATGGCCTACACGGCTACGGCATGGACTCCGGAGCCGCAGCAGCGGCCATGTACGATCCACA
      CGCCGGTCACCGGCCGCCCGGACTGCAGGGCCTCCCCTCGCACCACTCTCCGCACATGACGCACGCAGCGGCGGCGGCGG
      CCACAGTGGGCATGCACGGCTACCATTCGGGGGCCGGGGGTCATGGAACACCTAGTCATGTATCGCCGGTCGGTAATCAC
      CTAATGGGCGCAATACCCGAAGTACACAAACGTGATAAGGATGCGATTTATGAACATCCGCTATTCCCGCTTTTGGCGCT
      GATCTTTGAGAAGTGCGAATTGGCCACATGTACGCCGAGGGAGCCCGGTGTGCAAGGTGGCGATGTCTGTTCGTCGGAAT
      CGTTCAACGAGGATATTGCAATGTTCAGTAAACAGATAAGATCACAGAAACCCTATTATACCGCAGATCCCGAAGTCGAC
      TCACTGATGGTGCAAGCAATACAAGTACTTCGGTTTCACCTTTTAGAATTAGAAAAAGTACACGAGTTATGCGATAACTT
      CTGTCATCGGTATATATCGTGTTTAAAGGGTAAAATGCCAATAGATTTAGTGATCGACGAACGGGACACCACCAAACCAC
      CGGAGTTGGGATCGGCGAACGGAGAAGGGCGCAGCAACGCCGACTCCACATCGCACACCGATGGAGCTAGTACACCAGAC
      GTTGTGAGTACCCCCTTCGCGGGAGCACATGGTCCTATATTGGCGAGCTACAATGCGGTGGTGCACCCATGTTCGTAGTA
      CGATAACGACCTTCTTGCAAAAACGAAGCGGGTGCTCACAATGCCCTGGGATTAAATGAATCAATAATAATAATTGCGAT
      CAATCAATACGAAATGCCAATCGAGCGAATAACCGAGCGATAACCACAAAAAAAAGAAAGAAAAGAAAGTAAAGAAATGA
      ATGTTGCTGCACACTGTTCAAGCAAATTAAGTAAAATTAATTCACTTTGTGCGAAAACAAACATAATATTAATATTGATG
      AATTCAAATCCAAATCCGAACGCAGAAGAAGTTGTACGTCATTATGAACACACACAAAACACCCACACACACATTGTAAA
      TTAGTCAGAATCAGTAAATGAAAACAAAAAAAAAAAAAACATACAAAAAGCGAAGAAAGCCC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0082256
      4226
      FBtr0082255
      6557
      FBtr0100454
      3868
      FBtr0344145
      6340
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0099879
      266
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0081733
      472
      FBpp0081732
      487
      FBpp0099878
      266
      FBpp0310558
      266
      Comments

      Based on cDNA(s) that contain early stop codon; may or may not produce functional polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (2)