Open Close
General Information
Symbol
Dmel\CG2201-RE
Species
D. melanogaster
Annotation Symbol
CG2201-RE
FlyBase ID
FBtr0100511
Feature type
Associated gene
Evidence Rank
Length (nt)
1476
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCAGTTTGTTTTCGTACGCCCAGCTGGGAACTACTAACTGCTAAGAGCTCAACGAAAAGACTAACTGTGTGCCTTCGCTA
        CATTTTTTAAATTTATATAATACGATTTCTATCATATAGTACATAAATATTTGGATAAACTACGCGTAGCATGAAACAGC
        GAAATCTTAGGAATAATAAAGCACTCAAACGCCTCCAGCAGCCAGATAATAAAAATCTAAATTGTTGCTTGAGTAAACGT
        TGCAACTATGAAAATATCTGGCAGCATTTCAATAGCAATGCCACCCTTGAGGAAATTCGACATGCGGCCGCGCGTATTTG
        CCGAGACTATCTAACTGGGCCCTGGAAAGTGGTTACTCCGGAGAGTTTGGTAGTGAAGCGCATAAGTGGCGGGCTGTCAA
        ATTTCTTGTATTACGTAAGCCTTCCCGATTTAAATGACTACGATGAGCTGGACGAACAGAAACAGCAGCAGGAAGACATC
        ATAGGGGCCACCGCAACTGTGACCAATAGAAGCGGAGTTTTCATACACGACGATGAGTCGGCTGCCAAGGCGGTGGGCGT
        AACATTGATGGCGAGGGAATTAATAAATAACGATGACGTCGCCGACGCAGCTCCTGGCGCCACACAAGCACACAAACGTC
        AGCGATGCGATAGTAATAGTCGCGAATGCAGTTCTTCGAAACGATTGCACGCCCCCAAGCAGCAACCCCGTGAGGTCCTT
        CTGCGAATATATGGTCAGACCCATGGTGATCACGCCCTGGAGAGCATGATTACCGAGTCCGTGGTTTTCGCCCTTCTCAG
        TGAACGGAACTATGGGCCCAAACTGCACGGAATCTTTCCGGGCGGACGTATTGAACAATATATTCCGGTATAGTCAATAA
        GCCAAAAAAAAAAATGAGCAAAGCTTAAGCAAGATGTATTTTTCTGCGCATTTCTGTTCTTAACAAGAGAGAACGCAATT
        ATCGAGTCTCTCGCCTATCAGAAATTTTCAATTTTGGCAAATCGATAGAAGCATGCAAGAAAGATAATATGGAAATAACT
        TTAAATTATGGTCGAGATTAGAAAGCTGCGTTTCCAATAAGTTTTTGATATTCTTATAGAATTTGGCAAGACGTGTTTTT
        GAGCGTTAGAGTGGGCGCGGCAGCATCAGTAAAGAAACTTGCGCTGCTTCTATGTCTCGGAATCAACCTTCTAGGCTTTG
        TAGTTACTGAGATCTCGACGTTGACAAAACAATAGACGATGGATATAGCCAGAACACCTCGTATTTTGTTCCTGGTTTAG
        AATATACATATATACTTTATATGTTCGTAAAAGCCTCCTTCTTTCTGTTACATATTACATCTAGTATACCCTTGAACGCT
        ACGAGTAACGGAAAACAGAATATACGTTTCAAAAAGATCTCTTTTCAAAATAGTTTTAATTATTGTGTATCTATTCGTGG
        CTTCAAACGAATATTAAAACCAAACTACATTCGGCG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085921
        2010
        FBtr0085923
        2027
        FBtr0085922
        1814
        FBtr0305503
        2561
        FBtr0345685
        2463
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0099951
        240
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085275
        518
        FBpp0085277
        554
        FBpp0085276
        415
        FBpp0293955
        554
        FBpp0311734
        518
        Comments

        Based on evidence of retained intron or truncated transcript (disrupted by TE within intron); results in premature stop codon; may or may not produce functional polypeptide.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG2201-RE
        Secondary FlyBase IDs
          References (2)