Open Close
General Information
Symbol
Dmel\Deaf1-RB
Species
D. melanogaster
Annotation Symbol
CG8567-RB
FlyBase ID
FBtr0100666
Feature type
Associated gene
Evidence Rank
Length (nt)
2416
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CATGACAACTCTAGTTATCATGAGGAAGAAGAGGAGGATATCAACTTTTTTAGTAAATTAGTAAAGTTTAAGCTTAAAAA
      ATGTAAATTGCAATGAACCACCAGCTGTAAATAGGGCAATGCAACTTGAACGCGACCTGCGCGCAATTCGCATGTAAGTC
      GTGGTGAGCGCTGAAAAAAACGCGGATCGCGGCGGCAGCAACAACAACAACAACAACAGACCGTCCGTCGTCTCGGTAGA
      CGTCGAATAATATACATATATCGCAATAATCCAATTGCAAGTGGTAATCCGATGAACAATTCAAGTGCATTACTATCGTT
      GGACCGCAGAATAAGTGAAAGTGAACTGGCATAACAATACTATGGAACAGGTTGACTCCTCCACCGAGCTGCACCTGAAT
      AGGAAAGATCTGGCCGCGCTGGCCGAGGATGTTGTGAAAGAAGAGGTGATATTAGAAAGCTCCAGCCATCACCATCATCA
      TCATCACCACCAGTTGGACACCAAGGTTCGCATGGTCACATCCTCCTCCAACGACAACAGTGGTAGCGGCGGCGCCAGTG
      GCGGTACAAGCGGAGCGGGCGGAGGAAACGGCGGTGGCGGTGTGGTTTCGGTGCCCGTATCCCTGCCCATCGGTTCGATG
      ATAACCGGCACTACCTTCAATGTGATCACGCCCGACCAGCTGCCCCCTCACTTCAAGCCGATGCTGTGCGTCGACAACAA
      TGGCTACCTGTCCGGCAGCACGGTCAGCATGGGCAACGACCTCAAGACGATCGTCATCCAGCAACAGCAGACGCAACCAG
      GCGGCGGCGGTGGCGGCGCCAATAATGCGGGCACCAATACGACCGCCACAAATACGATTGGACTGAATCACGATGGCTCC
      GGGAGCAACAATAGCCACGACAGCCTGGCCACCTTGGAGCACGCCGCGGGCGGAGCGAGTGGCGTCGGCGGTGGCGGCGG
      CGGAACGGGTGGTGGCTCCTCGGGATGGTCGGAGAACCCGTCAACCCAGCACAATGAGGTCTTCCAGATCCGCTGCAAAA
      CCACCTGCGCCGAGTTATACCGCAGCAAGCTGGGCTCCGGCGGCCGTGGACGCTGTGTGAAGTACAAGGACAAGTGGCAT
      ACGCCCAGTGAGTTTGAGCATGTGTGTGGCCGGGGCTCCAGCAAGGATTGGAAGCGTTCGATCAAGTACGGCGGCAAATC
      GCTGCAGTCCCTCATCGATGAGGGTACGCTCACGCCGCACGCGACCAACTGCAGCTGCACCGTCTGCTGCGACGACGAAG
      CAGCTTCCGGCCCTGTCCGTCTCTTTACACCGTACAAGCGGCGGAAGCGGAATCAAACTGATCTCGATATGGAGTCTGGA
      CCCAAACGCAAGCGTAACACCCATCATAGTAACAACAACAACAGTAACACCAATAACAACAACACGAGCGGGAGCGGCGC
      CAACAACTGTGTGGATGTAACTGCAGCTGTGGCTGCTGCAACAGCCAGCGTGGTGGACGAGAACAACATGTTCCTGTCGG
      AAGAGAACATCACGTCCAAGGATGAGCCGTGGGCAGCGCTCAACGACAGCCTGGACACCTCCACCGAGCTGGTCGATCAG
      TCGCAGATGGGCAACACGTACGAACGGGAAACGTTTGTGGTGAACATCAACGATGGATCCTCCATCGCCGTCCTGGACAC
      CAGCCAGTCGATGAAGAACATCGAGCACGTGTACTGCACCATGGTCAAGGCCACCAATGACTTCAAACGCATGCTTAACG
      ACATGAAGCAGTCCTTCGAGCGTCGCATCGAGGTTCTGCAAAAGGAGCGCGATGCAGCGGTCAGCGCGATGCGTGTCCAA
      GTGCACGCGGACATCGATGATCCAAATATTTCAGGCTCCCTGCACGGCAACGAGATCATTTCGGCTAAGAAGTGCGCCAA
      CTGTAACCGCGAAGCATTGGCCGAGTGCTCACTGTGCCGAAAGACGCCGTACTGCTCGGAGTTCTGCCAGCGGAAGGATT
      GGAATGCTCACCAGGTGGAGTGCACAAGGAATCCACAAACGACAACGCAGCAGGTCATGCTGTTGATCGACGATCAGTCC
      TAAGCAACGTAACGAAATGTACATACAAATTTTACTACTAATTAATACGATTATAGGAAGTCGACCCCCCCTCCCCCAAG
      TCGCTAAAGTCCTTGCAGTTCGGTTCAGGTCAAACACCTGTAGTCCACTCCCACTCCCTTCCCCCTCGACCCCTCTCTTC
      CCCCAAAGTTCCCATTAGAAGGCCTGCATCCTCTTAGACGTATGTCCTACATTAATGTAATTCTTAACGTACATATAACT
      ATATAAATATATATACATTTTACTATTGAACGTAGGGCAAGCCAGCAAAGAAAAAAAAAATAACAAAAAACAAGCGAAAC
      GAAAGTAAAATTAATT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0074882
      2425
      FBtr0310476
      2042
      FBtr0332153
      3588
      FBtr0332726
      2033
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0100128
      573
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074651
      576
      FBpp0302624
      539
      FBpp0304463
      576
      FBpp0304972
      536
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Deaf1-RB
      Secondary FlyBase IDs
        References (2)