Open Close
General Information
Symbol
Dmel\side-VI-RB
Species
D. melanogaster
Annotation Symbol
CG34114-RB
FlyBase ID
FBtr0110808
Feature type
Associated gene
Evidence Rank
Length (nt)
6818
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 22 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTACTGAAAAGGTCGTGGATTTGTGTAGTTGTCGTGCTCCGTTGCCGCCGTTTGTCGTTCTCGTTTTCGTTGTCGTGTT
        GTCGTTGTCGTTGTCGCTGTCGTACGGGCGGCATCGCATCGCATCGCATCGCCTCACATCGCGTAGCCGCAGTGTTGACC
        GTCCGCATCCGCAAACTGGCGAACGAAGCAATTGGGCTGGAAATCAAGAAACAAGTGCCACCCAACCTAGTCAAAAGTAT
        ATATCTCAATCGGTTATCGCAATTGTTGAATGCTGAATATACAACAACCAAATAAAAATAGAAAAACGTCAAGCGAGACG
        AGAGTGCACGTGCTAGAAGTAGAAGTAGAAACATCTCAAACGCCTGCGTTAAGTTTCTGAATGTGTTGTTATGCAAATCG
        CGTCCTTTTTGGCTTGAGGCAACAATACAGTGAGTGTATGTGAGTGAGTGCGATTGGGAGCGTGTATGTGTGTGCCGCAG
        TTACAGTGTACGACTATATATATGTGCGCTTGTGTACGCGCCCACAATGCATAAATCAAAATACACATTATTGAGCCATA
        AATAAAGTTCGCATCGGCTGCTACTTTAAATATTGGCCTCGCGGCTGGCGGCGATTCGAAGACGAGAAAGTTAGCAGCAG
        AAGCAAAGCAAAAGCAAGGCCGACGAAATCGAAATTTATGCCTCGCACCCGCCAAATACTTTGCCATATTTTTTGCTCAA
        TTGCCTGCCGCTGCTCCTCCAACTCCTTCAGCTCCTTTTCATATGATGTGTGTGCGTCTCGCTGGCTGCATAAAAACTCG
        CTTAATGCCAACACGCCCTCTACAGGAGCAATAAGCAATAAGCACAGCAGCAGCAACAACTCCATTTCCTCCTAACCCCT
        GAGGGCTGATTTTATTACAAAGGCCGTAAAAAACGCCAAAAAGCGGAGTAAACGCCACAGCAAAAGGATACAATACGGCC
        GAAACAGGGTTATCACTCGAAGAGGAAAGGACACGGCGAAGCTCCAGGATGCGAGGCAAAAGGATTTGAAATTACATTTT
        TAATGCCGAGCGGGCAAGAAAAAGAGCGCGAAATGAGCAGCACGTGCGCGCTTTATTTTAAATATTTATAAACAAACAAC
        ACACGCGCACACCGACCAACACGCTTATCCACACACACACACACACACACACAAATTTAGGTGACCAAAGTTAAGCCTCG
        TCAAATTCTATTAAAAATTCATCTTAACGGTTATGCGTTTTGTACAAACAGTCGAGCGGCTAAGGAGCCGGGCAAAAAAT
        GTTTGTAAATATTAAAATGAATTTATGTGCAGAGCAAAAGTTTTTAATTAAGTGAAAAGCGAAAAGCCGAGTGGAAACGA
        TAAAAACGACCGGCCAAACAGGAAGGAATCATCGAGAGTGTGAATTAGAGCAGCGAGCTTACATATTTGAAGCGATGTTC
        GAGCAGCCAGAGCCCAATTTATTTGCATACCTAATGCTCGTGCAGTGAGCCTCGGCAAATTGCGAAGCCCAGCGCAGAAT
        ACTAACCAAACAGTTAACCAATAATTGGCCAATCGGATCGGGAGCAGCCAGCTATAACCATGTCCTTCACCGGTCCAATC
        CTAATATGCCTGATCATGGGAGCCATTACCCATGCAAATTCGCACGAGCATGCCGATGGCTTTAAGCCAGATGGTGAAAT
        CCTGCGCGTTCTGGTGAACAGCTCGGCACAAATCAAATGCGATGTGGGCTCCAGCCAGGCCGATGACAAAGTGCTTCTGG
        TTGTTTGGTACAAGAATAATTTACCCATTTACAGCTACGACACACGTGGCGCCCACGCTGGCACCCCATCCCATTGGCGT
        GACGAGGAGGTCCTTGAAGATCGGGCCGTATTTCGAACGCACAAGGAGCCGGCGGAATTGATTATAAATCCGGTTAAGGA
        AAAGGATGCGGGCAACTTTCGGTGTCGCGTGGACTTCAAGCTTTCGCAGACCCGCAACAGCAATGTCAATTTGGAGGTTG
        TCGTGCCGCCAACGCAGCCGATTATCTTCAATGAACGCCGCCTGCGAATCGATTCGAGAGCAGGTCCTTATGAAGAAGGT
        GGCAGCCTGGAAGTCACCTGCGTTGTTTACGGAGGCTCTCCGCCGCCGACAGTCATTTGGCTGATGAATGGGCAGCTGCA
        GAACAGCGTTGTCGATTACACATACGATGGCGCCATCAACAGCAAGCTGGTGGTACGCAACCTGTCAAGAATCCACCAGC
        ATGCGGTCTACACCTGCCAGGCCAGCAATTTCCACAAGAAATATGTGGCCACCAACATAACGATCGACCTATACCTGCGC
        CCTCTGTTGGTGGAAATCAGCTTCAATAATCAGCCGATGTCAGCGGATCGAAAGTATGAGATCGAGTGCCAGGCGATCGG
        ATCGAGGCCACCGGCCAAAATCACCTGGTGGATGGGCAATCTCGAGCTGCATGGCCATAGCCAGAAGGTTTCGGAGGATG
        GCAATGTCAGCACATCGGTGCTCTCGATCACACCCACAAGAGAGGACCATGGCAAGGCTTTATCCTGCAGGGCAACCAAT
        GAACTCGTTCGAAATGGCATTCGAGAAACGGCCATGAAGTTGAATGTGTTCTTCATTCCCACCTTGCAGCTGGACCTGGG
        CTCCAATCTGAATCCGGAGGATATCGAGGAAGGCGATGATGTCTACTTTGAGTGTAAAGTGCATGCAAATCCGGCTGCTT
        ATAAAGTTGTATGGAAGCATAATCATCAAATCATCCAGCACAACCAGCGAGCGGGCGTGATTGTCAGCAGCGGAGATCTG
        GCGCTCCAGGGCGTCACTCGTCACCAGGCTGGAAACTACACCTGCACCGCCTCGAACGTGGAGGGCGATGGGGATTCCAA
        TGTGGTCGAGCTGAAAGTGATGTATAAACCAATTTGCCGGCCCGATCAAAAGAAAATCTATGGAGTAGCGCGAAACGAGG
        CCGCCGAAATAGTGTGCGAAGTGGATGCCTTTCCGCCGCCGGAGAACTTCAAGTGGTCCTTCAACAACACGGCGGAGACC
        TTCGACATGCCGCAGAGCGGTTTCCGGCCCCATTCTGCCCAGGGTTCGACCCTCACCTACACCCCCGTCAAGGAAATGGA
        CTTTGGCACCATCATGTGCTGGGCCGACAACAATGTGGGTCAGCAGAAGGAGCCCTGTGTGTTCCATTTGATAGCCGCTG
        GCAAACCGGAAGCGCCCACCAATTGTACGGTGGTCAATCAAACGTCCGACTCGCTGGAGGTTTATTGCATTGAAGGATTC
        GACGGCGGAATGCGGCAGTGGTTCCTCATGGAAATCTTCGATCAGCACAGTGGTCAGCTTCAGGCCAACATTAGTGCCAA
        GTTTGCGGCCCTGAGTGTCACGGGTCTGGATGCAGGTCGTCTCTTCCGGATCTATGTGTATGCCGTCAATGGACGAGGAC
        GCAGCGATGCCATTGCCCTCGATGGATACACTTTGAAGGCGGCCGAAAAGCAAACCGTTGCCTTGACCTCCTACAAGGGC
        AGTGCCCAGAGTCCGGACAACTTTGAGCTGACACCGATCCTGTCGATTGGCATCTTCGTTGGCATCCTGGTGGCCATCGT
        GTGCATCGGAATCGGAACAATTGCCGCACTGAAGTTGCGCTCGCACAAGCATCAGCAGCAACAGAAATTCGTACATCCCA
        ATGCGAAATTCTCACGTCCGGGCAATTTGCAAATTAAGGACAAAATCTCATTGCCATTGAGTCACTCCGAGGAGATGTAC
        GACGAGAAGAATCCCGATGTTGTGCCCTACAATGAGGTTGATGGCGAATATAAACAAAAATCAGCAACACAAACGCCATC
        GGGACATCTCTCGACGACCAGCGAGGTGGAAATCAGCTGCAAGCCAGGCTCAACATCCGGCACCGGAATCGTCCAGGCCA
        ATTCGGCGGACAGTGGCACCTATCAGAGCAGCAAGGACGATGAGCTGCACTACGCGGAGCTGTCGCTGACCAACATGCCA
        TCTGGCAGCAGTGGCGCCTCCAAGAAGGGTCAGCCCATGGGCGGGGTGGGGGTGGTGCAGCACGTGGTGCAGCAGCAGCA
        GCAGCAGCAGCAGGGGCAGGTTCAGCATCCCCACCAGCTGCTGGGTGGCACCTTGCCACACGGCTCCAGTATGCGGAAGC
        TGCTGCCCACCATTCCGGCGACGGCGACGCTGCAGCGCCATAAGCCAAATGCGGGCGGAATGCAGCATCCGCACCAGCAC
        GCTCCGCCGCCCACGTACGACTACGATTACTTTGAGGAGCCAACGATATATGCGCAAATCGATGCGTACAAGACGATGCA
        GGTGGACACAGGAGTAGTTGTGGCAGGTGTTGGTGCCGGAGCAGGATCGGGTGTCAACGGTGCGGGGGCAAGCATTTCAT
        CGCCGGGGTCGCATGGCACTCCCTCGACGGTGTCGCCTGGAACCGTGCAAATGTACACCCTGCCCCAGCATCCCGGTGGC
        TACCACACACTGCCGCACAATCATCACGCACAGCAGCAGATGGCGGGCGGTCCGCAGAACTCCGCTTCGATGATGCAAAT
        GATGCAGCAGCAGCAGCAGCAGCAACAGCAAATGCACCACCATCCTGCGTCCAATATGCCGCCCTCCTACCAGCAACACC
        AGCAGCAACAGCAGCAGCAGCAAATGGCCCATGGCCAGATGCTGGTATCGAGCAACAGCAGCGGATTGGCCTCCACCACG
        GCGGCCGTGGCCAGTCCCAGTAGCTCATTATCGGGACTCTCGGGCGTGGGCAAGTCCTATTCGCGCGAAATAGTCACCGT
        TCGCACCCCGCTCATGTACTCGCAGCAGGAGAGCTGCGTCTAAGGTCTCCCTGGCATCATCTCGTGGATTTTTCCATATT
        CATACGCCCAGCCCCGAATACCCGAAATTTCCCAATTTAGCTAGTTATGTAAGTCTTGAGCTCTTCGTGGTTGGTGTCTA
        GGCTAAGTGTTGCCAAAACGAATTGAAGTGAATTGCATTGCGTTCTGAAGAATTGAAGGGATTCGTTTGTGTGCTCGTCG
        AGGAACTGAATATATTTTAATACAAAGCTCATACAAAGGCTGCCACAAATCTTCTGCACCGAGCATTACATTCCTATAAT
        ATGAAAAAATCGGTTATCTTATCAATGTGCAACCATTAAGCCCAAATTTATAATTCGGGAATTGAATTATTGAGTTATGC
        ATATTTAATTTTATATATATATGCGGCTGCTGCGGCAGTAACATATCATGAGATTATAATTTAGGTGTACATACGAACGA
        AAAATGTTTAATTAATGCGTCATAAAAATATAACGATTATATAAAACACCCAAGCTGGCAGAGATTTGGCACAGATTGCT
        ACTTTTTTGAATGCAGACAGAGAAATGGTGGTATTTAATTTTTATATATATACTTTCAAACAATTTAAAGAAAAGTGTAA
        TGCAGCAGAAGAAGATTGTTCCTTCCTTACAGTAAGTACTCAGATGGACGACACACAGCCTACGCCATATTTTTTCATCA
        GATTACTACACACTAACGAGAAGTATATATTAATTTCGAAGGGTACTTTGTAAATGTTTGTAAATGTCAGCTGAAGGAGC
        TGCAATTTTTAGGAATTGGGCTCAATGAACGCATACAACTAGAATAAATTTAGTAAGTATATCCTCCTTGACATAATAAT
        AATAGACTTAATGCTCACACTAACTCAACCGATGATGGGCGAGCAATGCGAAAGCGCACCTTCTTGGCAATTATATTGAA
        AATTAATTACATTATTCAAATATATGGTAAACAATATAAATAAAACGAACACTCACACCCCAACAGACACTCATACACAA
        ACAAACACACACACACACACACAAGCAAATTAGCTGCAATTAGCTTAGCATAAATGAATACTAAGTATTAATGTGTAAAT
        AGCAAAATCGTAAATCAAATGTATTACAGAACCCAAAAGCAAATCAAACAGAAGCGCTGCAAATTAATGAATGTAAATTA
        GTTGCACATTCTAACCAAAAAACTCCCAAAGACTATAAATAACAAAAAGAAAACACAACAAGGACCTATGGTTGGTATGT
        AAAATTTGAAAATAACAAAAATAACAAAATCAAGAAAAACAAGTGGGAAAGTTGTTGTTTGTAAATGGCATTTATATATC
        AAATTGTATTTTTTCTCTTCAATGTTTGAACTGTGAAAAGGCATAAAAGTAACAAAATAAATGCACATTGTAAATTATTG
        TTACATTTTAATATTTACGTTTTTAGTGAATGGAGGAGAGAACACACACTAAGAAAAACAGAAATCAATATTTCTAAAAA
        GTGTGTATAAAACCAAAAGTTGAGCCGTAAGTGTAACAGACAGATTATTGGCCCAGCACGGCAAAGGCAATTTCCATTTC
        CAGCTAGTTAAGATGAAAATAAGAAAATCGAAAAAAAAAAAAAACTAAAAAAAGAAACAAGTGATTTCTCTTACATCAAT
        TAGAACGAAATACAAACAAACGTGCATATATGGTTCGGTCATCATCATCATGTATGCGTATATTTCTGCATGTAAGTGTT
        CCAACCAATCTGAATATAAACTAAGTGTAGCTAATTTAACGTCTAAACGAAGCCATAAAAGATAATTGTAAAATATATTA
        ATGATTTAGTTTAAAGCCAGGCATATACTCTACAAATGAATTATGAATGTATGTTATGATTAAGCACTCGAAACGATATG
        GAAAATACCCCAGCCCTATCCCAGTGAATACAAGGAATACAATAATAACTTGAGACACAAGCAAACAACTGAATGAACTC
        AACCAAATAAATCCATAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0301070
        4318
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0110105
        1087
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290292
        760
        Comments

        5' exons of transcript supported by supported by IP17269 and IP17370

        Conservation across Drosophila species: Six newly annotated exons predicted by cross-species analysis and supported by BlastX data.

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG34114-RB
        side-VI-RB
        Secondary FlyBase IDs
          References (0)