Open Close
General Information
Symbol
Dmel\lt-RC
Species
D. melanogaster
Annotation Symbol
CG18028-RC
FlyBase ID
FBtr0111123
Feature type
Associated gene
Evidence Rank
Length (nt)
2760
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
Sequence
TATTATTGTCTATGGCGCTATTAGTAAATGTAAATAATAAAATAATACATCAGCTTGTGTATTTTCGTTGTTTGAAAATC
AGAAATTTCCGTTTGCTTTAAATGGCTAAAGCGTTGCCGCTCATCAGTTGTGACTCTTGGGCCGATAGCATAAATGAGGA
AGATGTGGAGCCCAAATTTAAGTATCACCGTCTCGCAAATGATTTAAAATACATGCTCAACGCTGATGTCATCACTTGTA
GCGCTGTACACTTAAAGGTGTGAGCCAACCACATATTATATAAGTATTTTAAAAAACGTACATATTTAGTTTCTTATATT
TGGAACTTTCCGAGGACGTGTTTGTATATTTGACCATCAAGGAAACTCAGTCTACTCAAATCTTAGCGCTAGCGAACGTC
ACACTCACCAAGTGGCAGTAAACAATATAGATGTAGATCATAAGGGCGAGTATGTGGCCACATGCTCCGACGACGGAAAA
GTTAACATAACGGGATTGTTTAGCTCTGATAACAATCACAGTCTCAGCTTTGGCAAATTTATAAAGGTCGTATCACTGGA
GCCCGATTCCAAAGCTCACATTAAAAGATTTGTAGTGGGCGACGACAAACTTATCTTGTACGAGCGAAACTTGCTAAAGA
AGCTTAAACCAGTTGAACTGTGCTCAGTCGAAGGCAGTGTTTTGTCAATCTGCTGGCATGGCAACTTTATTGCCTGGGCA
AGTCACATAGGAGTTCGAGTCTACGATTTAAACGAAAGATGCTCACTTGGATTAATAAAGTGGGAGGTTCCTCCTCAGGA
GCGATTAGAAAATTTTCGATGCCACCTTCGTTGGTCCAACAAGCATACATTATTAATTGGCTGGGTAGACACTATTCGAG
TTTGCGTAATTCGAAAGAGAAATTCAATCGAAGCTTCAACTGGCAATCTGCCTGTCTACATTGTGGATCCAATCTCGACA
TTTCAAACAACTTTCTACGTATGTGGGCTTGCACCATTATCTGCAAAGCAATTGGTTGTTCTTGGCTTTCGCAAGGAAAA
AAGCTCTTGTTTTAAAGCCCTACGACCTGTATTATGCGTTATTGAATACAAAATGAATAATAGCGAGGAAATCTGCACAG
ACAGTTTAACTTTACGCGGCTTTGAGGAGTACACCGTGAATGACTATAGTCTGGGTGGCATAATCGAGGAGAATCGCTTT
TATATTGTGGCCCCAAAGGATATTGTGGTAGCTAGTCTTATTGAAACAGATGATCGTATAGAATGGTTGATTAAACACAG
TAAATTTGAGGAGGCAATGGAACTTATATCTGCGAATGGAGGTAACGTTCCCGTACTTTCCGTTGCTAAACTTTATATCA
ACCATTTACTGGCGCTTAAGAAGTATGATGACGCAGCAAAACTTTGCCTCCGCATGCTAGGCAATGACAAAGTCCTTTGG
GAAGAGGAAGTTTTTAAGTTTGTAAAGTGTCAGCAGCTACGATCAGTTAGCGCCTATCTGCCGACTTCAGACGAATGCAA
ACTTGATCCCCATGTATACGAAATGGTTTTATACGAGTTTCTCAAATTTGATGTATGTGGTTTCCTGAATCTTATCAAGG
AATGGCCATCTCATCTTTATGACGGCCTGGCTGTTATTAACGCTATTCACGATAACTTTCGAAAGCACTATGCCAATCAG
TTGCTGGAATCATTGGCTCTTTTGTATTCCTATCAAGGCGACTTCGAAAGTGCTCTTCGCATGTATTTAAAGTTGCAGAA
CAAGGATGTCTTCCAATTAATTCGACGGTATGAGCTTTACGATGTCATTTCAAAACTGATTATTCCACTTATTCAATTGG
ATCGTGACTGCGCCTTTGAAATACTACTTGACAAGAAAAAAATAAAGACTGAGATAGTTGTCCACCAGCTAGAGCACAAT
CAAGAGTACCTGTACTGGTACTTAGATTCTTTACTTAAAAAGGATCCCAGTAATGTGTTTCAAAAAAAACTTATCTCCTT
ATATGCCATTTTCGATCGAAACAAACTATTGCCCTTTCTAAAGCGTTCAAAGGACTATGACATTCAGGAGGCGTTGGTCA
TATGCAAACAGGAAAACTTTTATCCAGAAATAGTCTACCTGCTCGGGTGTATGGGTGGCGTAGAAGCGTCCGAAGCACTT
AATATTATTATTCATCGCATCAGAGACATAGAAATGGCCATAGAGTTTTGCAAGGAGCACGATGACAGCGATCTTTGGAA
TGCACTTATAAATGAATTTAGCAAGCACCCTGAAATTGTGACCAAAGTTTTGGACGGCATAGTTGACTACTTTAGCCCAG
CGGTGGTTGTTGGAAAGATCAAAATGGGACAGAACATTCCAAATCTTCGACAATCACTTATAAAAATGCTGCGCCACTAC
AATCTTCAAGGTGAAATTTTATCCTCCGCCCAACAAATTCAACTTAATGACTATTTTGAAATTCACTCGGAGATAGTCAC
CACGCAAAGACGAGGTCAGCAGGTTTCCTACGAACAACTATGCTCATTGTGCCACCGTCCAGTACTGATGGCAGGCACAC
ACTTGTATTGTATAATCAGGTTAGAGTGTGGTCATGTATACCATAAACCGTGCATACAAGGTGAATTGCTTAAAAATTGC
AACGAGTGTAACCTTTGGAAGTTAACCGTGGGGAAATAGGTTTATAGCGACATCATAACTGTTACCCCGGCGTCCTGTTA
GGGGAATTAAGAATAAATAAACTTTATAGCTTAATTTCTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0111125
2804
FBtr0333519
4404
FBtr0344082
5316
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0110415
528
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0110417
841
FBpp0305699
841
FBpp0310509
841
Comments

Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG18028-RC
lt-RC
Secondary FlyBase IDs
    References (0)