Open Close
General Information
Symbol
Dmel\Spf45-RA
Species
D. melanogaster
Annotation Symbol
CG17540-RA
FlyBase ID
FBtr0111239
Feature type
Associated gene
Evidence Rank
Length (nt)
1397
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AAATAAAAACATTGTTGAAGCTCGTTGTCATCAATATCTTAAGGTGGTGCTAGTATTGATATATTTGTTAATGGATTTGT
      ATGACGGCATTGATACGAGGGCTCGATCTAGCCAGATTGATGGATGGTCTTCGGGAATAAAAATGTTACAGACCCAGCTG
      GCAGTAAAAATGGCTGTCAAAAAACCACTTATGACGCCAGTGGTTAATCTAAGGTCCAAACGCCTTGCAGATCCAGAAGT
      TACATGTTTTGCTCCAATTACTACAGTTGTATCCAAACCATTAATAAGTGGTAAAGCCCTTCCATCCATACTGGAAAGGA
      TAAACAGGGGGGACTGGGACGTTGCCGATGAATACGATCCTCAAAGGCCAAATGAATATGAAAAACTTAAAGAGAAAAGT
      AATGGCAGTGACAAAAATCGAGCAGGCGTAAGTGATCGAGAAGACCGAGATGACAAAGAAAAAGATCGTAAACGTGGACG
      CGTCGGTCGTCGAGAATTTTATAGAGACGAAGTCTCAGCCCCTAACCTGAAGCTCAGCGGGTTTGGCCACCGGCAAAACG
      ATGATGACATGTACTTGCCATCTCCGGGCCTTGTAGCTAAACAGGGAGGTGCCACAATCGCTCCCCCTCCTTCCCTCCAA
      GAAATGTCCATTGATAGTGGTTGTGAAGCCACTAATACTATGCCATATTCTGCCAGCTCGGTGGCCGCCAAAATTATGGC
      AAAATATGGGTTTAAGGATGGTCAAGGTCTCGGAAAATCGGAGCAGGGCATGGCCATAGCTCTTCAAGTAGAGAAAACCT
      CCAAACGTGGTGGACGGATCATACACGAAAAAGACGTTTTTCTGCCACCCCTAGCATTGTCGCCACCTTCTATTGGCTCC
      CAAATAGGAACAAGTCCCAGCCACAAGGCCATGCCTCCTCCCCAGATGGTAGACACGGCGGCTGAGAGTGGTGACATCGG
      ATACAGCATTACGGAGATTATGAAATCACCAAGCAAGGTTGTTCTTCTACGCAACATGGTAGGACCCGGGGACGTTGACG
      AAGAATTGGAACCCGAGGTAAAAGACGAATGCAACACCAAGTACGGGGAAGTGAACAGTGTAATCATTCACGAATCGTTC
      GGAACTGTGCCAGAAGATGCAGTTAAAATATTCGTAGAGTTTAGGCGGATCGAAAGTGCAATTAAAGCTGTAGTGGACCT
      TAATGGACGTTTTTTTGGAGGACGTCAAGTGCGAGCGGGGTTTTACAACTATGATAAGTTTAAATGTTTCCAATTACATT
      AGAACTAATACAACTAAGATTGCATTTATTTTTTTCTAAGTTATTGATAGCCTAAAAAATGTTTACCGCACAGAACTAGT
      CTTGTAAATTTCTATTAAAAACTACTTTCTATCAAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0111240
      1354
      FBtr0111241
      1257
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0110561
      403
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0110573
      371
      FBpp0110506
      363
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG17540-RA
      Spf45-RA
      Secondary FlyBase IDs
        References (0)