Open Close
General Information
Symbol
Dmel\Spf45-RC
Species
D. melanogaster
Annotation Symbol
CG17540-RC
FlyBase ID
FBtr0111241
Feature type
Associated gene
Evidence Rank
Length (nt)
1257
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAATCTGCCGATATAGATCATACAATTATTAATACACCCTATGTAGCTTATGACGCCAGTGGTTAATCTAAGGTCCAAA
        CGCCTTGCAGATCCAGAAGTTACATGTTTTGCTCCAATTACTACAGTTGTATCCAAACCATTAATAAGTGGTAAAGCCCT
        TCCATCCATACTGGAAAGGATAAACAGGGGGGACTGGGACGTTGCCGATGAATACGATCCTCAAAGGCCAAATGAATATG
        AAAAACTTAAAGAGAAAAGTAATGGCAGTGACAAAAATCGAGCAGGCGTAAGTGATCGAGAAGACCGAGATGACAAAGAA
        AAAGATCGTAAACGTGGACGCGTCGGTCGTCGAGAATTTTATAGAGACGAAGTCTCAGCCCCTAACCTGAAGCTCAGCGG
        GTTTGGCCACCGGCAAAACGATGATGACATGTACTTGCCATCTCCGGGCCTTGTAGCTAAACAGGGAGGTGCCACAATCG
        CTCCCCCTCCTTCCCTCCAAGAAATGTCCATTGATAGTGGTTGTGAAGCCACTAATACTATGCCATATTCTGCCAGCTCG
        GTGGCCGCCAAAATTATGGCAAAATATGGGTTTAAGGATGGTCAAGGTCTCGGAAAATCGGAGCAGGGCATGGCCATAGC
        TCTTCAAGTAGAGAAAACCTCCAAACGTGGTGGACGGATCATACACGAAAAAGACGTTTTTCTGCCACCCCTAGCATTGT
        CGCCACCTTCTATTGGCTCCCAAATAGGAACAAGTCCCAGCCACAAGGCCATGCCTCCTCCCCAGATGGTAGACACGGCG
        GCTGAGAGTGGTGACATCGGATACAGCATTACGGAGATTATGAAATCACCAAGCAAGGTTGTTCTTCTACGCAACATGGT
        AGGACCCGGGGACGTTGACGAAGAATTGGAACCCGAGGTAAAAGACGAATGCAACACCAAGTACGGGGAAGTGAACAGTG
        TAATCATTCACGAATCGTTCGGAACTGTGCCAGAAGATGCAGTTAAAATATTCGTAGAGTTTAGGCGGATCGAAAGTGCA
        ATTAAAGCTGTAGTGGACCTTAATGGACGTTTTTTTGGAGGACGTCAAGTGCGAGCGGGGTTTTACAACTATGATAAGTT
        TAAATGTTTCCAATTACATTAGAACTAATACAACTAAGATTGCATTTATTTTTTTCTAAGTTATTGATAGCCTAAAAAAT
        GTTTACCGCACAGAACTAGTCTTGTAAATTTCTATTAAAAACTACTTTCTATCAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0111239
        1397
        FBtr0111240
        1354
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0110506
        363
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0110561
        403
        FBpp0110573
        371
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG17540-RC
        Spf45-RC
        Secondary FlyBase IDs
          References (0)