Open Close
General Information
Symbol
Dmel\Pvf3-RA
Species
D. melanogaster
Annotation Symbol
CG34378-RA
FlyBase ID
FBtr0112612
Feature type
Associated gene
Evidence Rank
Length (nt)
3486
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAGAACCACTAATTAATTAAAATTGAACGAAACGCAAATGGAATTGTAAAGCGCATTAAAAAATAGGGTACAAAATAGT
        TGAAGAAGTGTAGTGGGCAATTAATAAAGAAAGAGAGAAGTGTCTAAACAAAATGCAGTTAAATACCCTGCGGCTTGCCT
        TGATTTTCCTAAGTTTTGTTCGCCTGGAGGCGCAGGCTAATGTTCAGAATAATGGCTGGCAGAAGGTGTTGCCTGATGAC
        TTCAGACGAGAACGTGATAAAAGTTCAACCAGAACGCGCCGGAATCCGCAGGAGGAATTGCGCCTGAGACACGAGCAGCA
        TCATTTGCGCCTGCAGCAACATCAGATGGCGTGGGAGCTGGACTTGCAGCGGCAGCTGCAGCAGCATCTGCAGGAGCAGC
        AGTCGGAGCAGTCGGAGCAGCAGAGCCGGCCGGTGCGTCATCATCAGCATAAATCTCACACCAAGGAACTGGCCAAGAAG
        CCCATTAGACGGGCACCGAGTTTCGGCGATGACAAGGCCAAGATGGTGCAGAAGCGCAGACTACACTACAACGAGTACGA
        TAACGAAGATCTCGAGCTGCACACCATCGAAACCGGCGATCAGGGGACCTTCACCCCGCGGCAGTGGCAGCAAATCGAGA
        TTGCCCATCGGCGGCAGAAGGAGCAACATCAATTGCAGTTGCTGGCGCAACGACAACAGCAGCGACAACTGCTGACAACG
        ACAACGGCAACGGCAACGGCAATGGCAATGGCAACAACGTCGAAAGCAACGGAACCCAATGATGCCAAATCGGAGGATAA
        TGATGTAAGTGCTGCAAAGACATTAGAAGACAATGATGGCCATGATGTGGAGAACATTTACGCACGCAATTATGTTGCGG
        CGAAAGTTGGCCAGAAGAAGGAGGACCAGTTGGGAACCCCCGAAGCGGTGATCAAAGCGAGACGCCTCCATGCTCAGAAG
        CAGAAGAGTGAACGAGCTCTTGCCCACGCCCATATGAACCAGGTGCTGAAGGAGGCCACCTGCCGCATTCCCCAGAAACG
        TTGTCAGCTGGTCCAGCAGGATCCTTCCAAGATCTATACGCCTCACTGCACCATCCTGCATCGCTGCAGCGAGGACAGTG
        GTTGTTGCCCCAGCAGAAGCCAAATTTGTGCCGCCAAGAGCACCCACAACGTTGAGCTGCACTTCTTCGTGAAGAGCAGT
        AAGCATCGCAGTGTAATCGAGAAGCGAACCTTTGTGAACCACACGGAGTGCCACTGCATCGAACGATCGACCTACAACGA
        GGAGACGGCCATGGCCCACTACGGCCAGTCGGTGGTGCGGGCCACCATACTGAGTTGCACCTGTCCGAAGAGCTTTGAGA
        AGATCCTGCAGGACGATGGGCAGTGCAGGTGCGACTGCAGCTCCGGCAACTACGACTGCGACTGGCTGAAGCGGGGCAAC
        GAGCACTTTGCCATGAACGATCGCAAGTGCATACAGCAAGGTCGCTGCAAGCCGCCCACGTGTGAGTTTGGATTGTACAT
        GGACAAACACGGTCGCTGTCCCAAGCAACACGAACAGCCATCCTACAATGCCATGTCATAAGCGGGAGGAATCCCAACGT
        GAAGCCAGGAAAAGTATTATTTGGTCTGAAGAAAACTCAAATCTCAAACAAAGAGGAAAATCCAGAGCGATTCTTCTCTT
        CTGACAAGAGTAAAGGCGAAATGAGAGACGTGAATTTAGTTGCATATCCTATACAAAACAATAAGAAAGTAAAACGATGG
        GTCGATTAGCAAGAAGCACTTTAAAGCATTTCTAGGAGTTTTCCCTCCTTGAAATCTGTAATGTCTAGAACAGAATAATT
        GGAACAAATAAATCTATACATGGGTTGGGTCGGAAAACAACCAAAATGAATATTCGACAACAAGCAGAAAAAAAATAACA
        TTTTCTACAGGTTTAAATCAAAATTAAAGTTGAGAAAACTTTTACTAAGAAAAGTATAAAACAGATTATGCATTTTCTAC
        TTCAAAAATCGACCCAGCTGATTGTGTATTAGATTTATTAGGACTCCAATCCGAAGAGCCATTAAAGTTAGGTGCAAACA
        AAAATCTGTATCTTAGCAAATGGAAATAAGACTTTTTTGCGCATGTTTTACTAAGAGATAGAAAAACACATAAGCCAATA
        TGAATTTGTAGCATTGTTCTTAAGTGTTTCAATATACAACATCCACAAATAAACCAGAATAAATTATGTGTGTGTTTTAT
        GCGTATGCTAAATGAAATTCCAAATATATAAATTGACTGCGTTTTTAGTTTTAATTGACTAATGTTATGTTATTTAATTA
        GTTATTTAATTATAATAAAACGAACAAACGAAAACGAATCACTAATATTACAATTGAAATATATAAATTACCCATATAGG
        AGCAAATATATTGTTCATGTTATTTAAGCTAAGTTTTAACACAATTCAAACAAAAACCATCCTGGATAAGTCGCAACAAA
        AACAAAATTAAATTTTCATATTTAATTTCTAGTCAAATTTTCATTTTGTTTTTCCACGGCCACGAATGTTTAATCGAATG
        GAAATTCCGCCATTGAACTCAGCAAATCAAACGGCATTTAAAGCGGAAAACAAAAAACAGTAAACTAACCATAAATATAG
        CAGAATAAATGTATAAACCATATTGAACGTAAACTAGCCCACAACTTTCCTGCTTTTTTCTGCATTTGATAGTGACAACT
        AAACTAAACATAGGATATTTTCAAATATCGCATAAGTACATTCTGGGAAAAGCCCGATTTTAGACACAATTTCATTTTCA
        TTCGACCCGTGCACATGCCTTAGTTTAAGTTACTTAAATAGTTCCGACACCGTATCGAGCACTGTACATATATTTTAGAA
        ACCTACATTTAAGCGGCACACAAAAGTGAATCCGTTTGGCACGAATTATGACGCAAATTGTTTCAGAGGCAGAGAAATTA
        TTCCCGCATTGCATAACGCATTTGCATATTAATGACATTTGCTTTATGGTTTAGTTATTAATATCAAACGGAATTTGGGG
        CTTTAATTATTGTGAATTCATTTACCATTTAGCCAGATACCAAATGCCGTTTAATGACCTGTGCCTCATTTCTATTTATC
        CTGCGTAATTACACGTTCGCCATAATTATGGAGCAATCTATTTGCTCAAGTTTAAATATTTATTGAAATTCGCAGCCCAC
        TTTGAATAAGCAAGCATACGCATATAGGAAACGCAATCTCAATGCGACGTTGAATGTGTCATGAATATTTCAATAAATCT
        GTGTAATTGTTAATAGAAGCTACCACAAGATACCAAGCAGAATATACGAAACATTACATTTCAAAATGATTTTATTTACA
        ACTCTTAGCATAAAATTTAATGTATAAAAATGAATGTAAGCGATAAGCTGAAAAACAAAACCAATACTAATAAAACAAAA
        CATATTATTACTATGCGAAAATCCAAATAAATATGAAAGTGAACAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0112611
        3387
        FBtr0301525
        2485
        FBtr0342658
        4852
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0111524
        482
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0111523
        651
        FBpp0290740
        469
        FBpp0309572
        638
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG34378-RA
        Pvf3-RA
        Secondary FlyBase IDs
        • FBtr0079422
        References (0)