Open Close
General Information
Symbol
Dmel\Arp2-RB
Species
D. melanogaster
Annotation Symbol
CG9901-RB
FlyBase ID
FBtr0112868
Feature type
Associated gene
Evidence Rank
Length (nt)
2475
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 47 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CATCTATTTTTATTCAACTCTGGGGAGTAACGAGGGAGTTTTTGTACAGCAGTATAACTAAATTATAAGTATAAATAGTC
          GATAGCGGCAAACTGTTTCGGCCTAAATTTAATTGCGAGTCTAAATTAAGAGTTCAATTCCCAATAACCGCCAAACGAAG
          CGGCGATAAACAGGCGCTGCGAGCTGTGATTTCAAACCGAATCACAACCAACACCCAAAAAGGCAACCTGGTCGCGTCAT
          CAGTGGAAGTGGAAAGGCAGTTGCCACAGCAGAGGCAGAAGCAACGGGAGTAGCAGAAGCAGTGGTTTTCCAGAGATCCG
          GTTTTGAGTCCTTCAAGCATGGACAGCAAGGGTCGAAATGTTATCGTCTGTGATAACGGCACTGGGTTCGTTAAGTGCGG
          ATATGCCGGCAGCAATTTCCCCACCCACATTTTTCCCTCGATGGTGGGACGACCCATGATTCGGGCGGTCAACAAAATCG
          GCGATATCGAAGTCAAGGATCTGATGGTCGGCGATGAGGCCTCACAGCTGCGATCCCTGCTGGAGGTCTCCTATCCGATG
          GAGAACGGTGTGGTGCGCAACTGGGACGACATGTGCCACGTGTGGGACTACACGTTCGGTCCCAAAAAGATGGACATCGA
          TCCGACGAACACAAAAATCCTGCTAACCGAGCCGCCCATGAATCCCACAAAGAATCGCGAGAAGATGATTGAGGTGATGT
          TCGAGAAATATGGCTTCGATTCGGCGTACATTGCCATCCAGGCCGTGCTGACGCTATATGCCCAGGGTCTGATCTCTGGC
          GTGGTGATCGATTCGGGCGATGGTGTAACGCATATATGTCCCGTCTACGAGGAGTTTGCCCTGCCCCATCTGACGCGACG
          ATTGGACATTGCCGGTCGGGATATCACTCGCTATTTGATTAAGTTACTGTTACTACGTGGCTACGCTTTCAATCATTCCG
          CCGACTTCGAAACGGTTCGCATAATGAAGGAGAAGCTCTGCTACATTGGCTACGACATCGAGATGGAGCAGCGTTTGGCC
          CTGGAGACGACGGTGCTGGTGGAATCGTACACGCTACCCGACGGTCGTGTTATCAAGGTCGGTGGCGAGAGATTTGAGGC
          GCCAGAGGCTCTGTTCCAGCCGCATTTGATCAACGTCGAGGGACCGGGCATTGCGGAACTGGCCTTCAACACCATCCAGG
          CGGCAGACATCGACATACGGCCCGAACTCTACAAGCACATAGTTCTGTCCGGCGGCTCCACCATGTATCCGGGTCTTCCC
          AGTCGGCTGGAGCGTGAGATCAAACAGCTGTACCTGGAGCGGGTACTCAAGAACGATACGGAAAAGCTGGCGAAATTCAA
          AATACGCATTGAGGATCCACCGCGACGCAAGGATATGGTCTTTATCGGCGGAGCTGTTCTGGCGGAGGTGACAAAGGATC
          GCGACGGCTTCTGGATGTCCAAGCAGGAGTATCAGGAACAGGGTCTCAAAGTATTGCAAAAGCTGCAAAAGATCAGTCAC
          TAGAGGCGGATGGATGCGAAATCAGTGTGTGTGTGTGTGCGGACCGCAAGAAATAGGATAAAAAAGTGATAGATTTCTTT
          TCTCTATTTTCTATAGGTTTAAACCTTTCAGATTTACGTGATATATCCGTCTATATATGTTTTTTTTTTTGTGTGTGCCT
          GTGCGAGTGGGCGTGTCTGTTGAGCAGGATTGGTCCACTTGCCCTTAGATTATCTATAATCGCAGACATGTCGTCACTGG
          TCGTTATCCCCGTACAATATAATGTAATATTTCTTTGAGCGCGAAAACTTTAATTCGATAGTCGCCTAAATTGTGTAACC
          CTGCATTAGTGTGTTTAATTGTTTATAATTACGTCTAAAATTCAAACCCAAAAGCCCTTTTCTTTAATGAATACGCATAT
          ATAACTATATATATATACATATATAAATTCAAAGCACCTCGAGTGCGGCGATATTTTTGTAAACGCAAAATGTTTCATTT
          CCAGCGAGTATTTCACATTAAGTATTAACTAGGCCAAGTCTGCTAGTAGCAGCTACTAAAATCGTGTGTGTGTTAAGACA
          GAGACAGAGACAGAGGAAATATAACGAGGAAGTTGCATAGCACAGAAGGAGAAAGCGCGAGTTCGGTCGTTAACTAAATA
          CACTGATTGATTCGATCCCGTCTCGCCTCCCGACACTCGACCTTAAAGTAAGCATTTCTGGATTGTCTCCAACTAGATAA
          AGATGAAGTTACCTACCCATAAAGATACAGATAATCGAAGTCACAAGATTACGCATTTACGTTGCCCCATAATCGAAAGT
          ACCATCAGTCGAAGTGTTAAATTTGATTTAATTTCCTTACCTGCCTTTTCTAGTTAGTTGCAATTTGATGATTGTTGGGG
          TCGCAACTATCGGCATATGATGAATAGTATATACATATACATATGTGTGATCCATATACATATATCCGTATATGT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0074295
          2219
          FBtr0310673
          2217
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0111781
          394
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0074070
          394
          FBpp0302793
          399
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcriptional initiation is supported by data presented in FBrf0213250.

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          Arp14D-RB
          Arp2-RB
          Secondary FlyBase IDs
            References (0)