Open Close
General Information
Symbol
Dmel\RhoGAP1A-RA
Species
D. melanogaster
Annotation Symbol
CG40494-RA
FlyBase ID
FBtr0112919
Feature type
Associated gene
Evidence Rank
Length (nt)
5082
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 34 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGATAAACGATATTTTTTTTTTGTAAAATCGGCTTCGCTGGAAATCTGCGAAAATATTTCTGTTTTGTCTAATTGTTAAA
      GTCCATTCAATGTGAAAATAAATTGTAGGAATGGTGAATAAAACCCGTGTTCGAAAATGAAACGGGAAAAAGGCGACAAC
      GCACAGCTGGTGCTTGTTCTTATATAAAAGGCAACAACGGCCTCTCCGCGTCATCATCTTGAATAATAATCATCAGCATT
      TTTCAATTAATAAGGAAAACGGTTAATATAAAAGCAAGCACCCGAAGAAGGAGCTTGCACCAACATGAGCGTTTTCGATG
      ACTTCCAGCGTCTGTGGATGCAGCGATTTCCGCAAAGCTCTCTATCCGATGCATGGGAACAAGATGTTCGGGCTAGTCTC
      GAGCGACACAAAGTGCGCATTAATGAGCTAAGCAAGGAGCTTGAGCAGGAGACGCTCTATGTGGAGTATCTAGAGCGTCT
      GCTGTCCGACGTGGAACGGTATCGCGTTTCTGGCGGGGATCCAAAGGCACTCTTTGAGGCTGCTAGCGGTAGTTGTGCTA
      GCAGCAATAACAGCAACTGCAGCAGCACCACCAATGGAGCTACACAAGAAGAAAGCAACACTAATCTGGACAAAGATTTT
      AAATCTAGTTTAAATCTGCGCGAGTCTCCTTCTTCCACTGGCGCCAAGGACAAGGATCGCCTGTCGCTCAACCCAGACAA
      CAAATACACAACACACACAAATGCCGTTATAGGTGGGATCGGATCGGAAAAGGTGAGCGGTCCACTTCACTCCACTCAGA
      TCACGGCGGACGGCAAACGAACAGGGGAGCTGTATTTAAAGCGGGAAGAAGACAAATGCAAGGATAGTAATAGTGAGGAC
      ACCGATGGGGCCCTGCAGCAGTGCATCACGGAATTGGCGGCGTCTTTAAAAGCCCAGCCGGATAACGTGGCAGGAGGGCG
      TCTAGAAAACGATGTCGATATCGATAAACCGCTGCGCAAGTCGACGTCACAATACGTTACTGTCATTCAGGTCAAAGAGG
      CCAAAGACAAAGAAAGCGCTGATGGAACTACCTCGTCATCGGGGATCGGTGAACCGCAGCAGCAACCCACTCCACCATCC
      ACATTTTCTCGATATTCGGAGGCCACCGCTCCACCGCTTTCGCCATCGCTCACATCGTACGCTGCCCACGTAGAGGCCAA
      GAAGAAAATGCCACCCAGACCTCCGCCAAAGAATATTCGGCGAGTTGAGCCCCCTACCATTCCCAGCCAGCAGCTATCGT
      CTTCGCCCAAAAGGGAGACATATATGATCAACACGATGCCAAGCAGTTCAAGCGGCAGTCTCTGCATTGACAGCCTGGGC
      AATTCGCTGGAGCGGAACATCAAGCCGTCTGATATACTACGTCAGAAATCATCTGATAATTTGGATTCCAAGTACTCGGC
      AAAACGGAAAACCACACCGGAGCTTAGTAAATTTGTGAACGTAAACAATCCTGAATTAATGGAGGAGCTCGGTCGTAAGA
      TGGTAAGCAAGGCAGACAGCCTGGAACAAACGAGGAGGAACGACTCGTCGCCTTCTGGCTGTGGTAGCCTAGGACGCACT
      TCCTCCACGCCTGGGCGATCGTTGACTCCTGGACGAACCGGAGTTGGTGCCTCGCCAACTGGTAGTCTAAGTAAAACCGG
      AAAACTGGCAATGGCGGACAGCAGCTCCACTAGCAGTCTAGAGAGGAGATCGTGCCTGCAGGCTGTCGATGCGGACATTG
      GAACGGAATCGCGGGAATCGGGTGCCAACCAGCGTAGTGTAGGGTCCAAGGAGTCGCTGACATCACAAGGCATATCGGAG
      GTGATCAAGAGCTACGAAAGCGTGTCTTCGCTAAGTTCGGAAAGTGCAAAGGCGGTGGCTTCCCAACAGTCGGCGGCAGC
      GGGCGGAGCTTTAGCGGAGTGTGAACCGTACTATGATAGCGTACCGCTCGACAACGGCGACGGAGAATACGTTTTTATTA
      AGCCCGGCCGCACCGGATCCTCATCCAGTCGCGATGATTTGTCGACGCCTGGGAGCAGCATTTTGCCTTTGCCTAATGTA
      GCGGATCCCGAATCTCCAGGCAGGACCTCTAACTACGTCAACATCGATTTCTTCCTTCAGCAAGGAATTGAGACGCGCTC
      CAGTTCGCTAGACAGTGACGGGGAGTACGAGGGTCCGCCCATATTACGCACCATTTCGCACGACGATCAAACCACAACAC
      AAACTACTCCGGGAGCAATTCGCAAGAACTTAGTTTCGGCGATACTTGTTTGTGGAAATGCGCGCGGTGCTAAAATACGT
      TCCATACTTAGCTCAATTATTCAAAGTGAGACTATCTACGTGGAATGCCTCAATAAAATGATGCAGTACAAGAAGGCCAT
      CCACGCAACCCTAACTACTTCGCAGCCTGTGATCAGGGAGGAGGAGGAGAACACAATTTTCTTTAAAATTGATGAGCTTT
      ACGATCTGCATACCGGTTTCTTATCTGATTTAAAGACTATTGTGTCTCACGAGGGTGGTGATGTGCTGATCGGTGAGCCG
      TTTCGTCGACTGGCGGAGATGTTTGACTTATACAGTGCCTTTTTGCACAACTACAAAAATGCTATTGAGACTGTGAAGAA
      GTGCAGTGCCAATAACCCCCAGTTTAAAAAGATCGTCTCCACCATTGTGCTTAATCTGCAGACGGAACAATCGCTAACTC
      TCGAGGATCTATTGCACAAACCTGTTGCGAGGGTACAAATCAACGCATTGGTCTTCAACGATTTGCTACGCGAAACCCCA
      AATGCGCATCCGGATCACCAGCCATTAAGGCAGGCGCAAAAGATTATTCAGATGTTCCTCAATCAGTTCAATGTGGTCAA
      TCAGCGGTTGCCCATTGAATCGAATCGAAATTTAAGACGCATGGTGCGTAATTCTTTTATTGTAGAACTTGTCGATGGAC
      ATCGTAAGCTGCGGCATCTCTTTCTTTTTAATGATGTCATCGCATGTGCCAAATACAAAGCATTAGGCCGCGATCGTATC
      GACTATGAGCTCAAATGGTTCATTCCGCTAAAAGACGTATCCATTTACGAGGAAGCAGATCCGGCGGTCGAGCTTAAGGA
      ATCTAGTCCAGCAAACATTTCGCAAGTAAAACGCAATTTGCGATCCGTTCGAGATCAATTGGCCATGGAGGTGGCTAACA
      GTGGAAGTGGAGCCTTCCGTTCCGGTGATAAGTATCGCCGCAAGCTGGCGGATCTGGAATCACAGCTGGTGCTGGCAACG
      CCCAATTTAGTGTTGCGCCTGGGGAACAAGGCAAATAATAAAACCATAACCTTCTTTCTTAGCTCGGATTTTGAGAGGAC
      GCAGTGGATCGACTCAATCTTATCCCTTAAGCAAAAATGCAACCTGCCTGGAGCAAATACTATTAATTCCCTGGAGGTTA
      CCGCCTTCATTGTAGCCATGCAGAAGGGCATGAAAACCGAAATGGGTTCATATCTTATGCGTAACACTAACGACGAGAGC
      CTGTTGGTTGGGGACCTGTACATGGGAGTTCATGGATTGGAAGGACTGGAGCAAGCGAACGACCTGTACATCTGCGTCGA
      GGTGGACTCCTATGGCCACTATTTTCGCAAGGCCACCACCAAGAAGATATGTCGCAGTCAAACGCCGCTCTGGAACGAAA
      GCTTTATGCTGGAACTGGAGGGCAGCCAGAATGTACGCATTCTTCTTTATGAGGCTAAGGAGCGACCGCTTCTTAAAGCC
      AAGCACATACTTAAGTTGAGTTTAAGTTGGCTGACAGAAACAACGCAGCCGAAGTCAATTAAACTTACTGAGACCTTAGA
      GCTCGGCTGTAGCTTCCGTTTTATACCAGGCGAGCTCTTCCGCGGCAGCACAAAGCCAGGAGCCCTCTTCGGTGCCAAAA
      TGAGTCAAGTATTAAAACGTGAAAAACGCGACATTCCGTTCATCATAGGCGCCTGCATTCGGGAGGTAGAGCGGCGTGGG
      ATGCTGGAGGTTGGCTGCTACCGCGTCAGCGGTTCCGCTTCTGATTTGGCGAAGCTGAAGAAGGCCTTTGAGTCTGATGC
      CTATGAGGCGGAGCAGTTGCTACGCGAGGTGGACATCCATTCGGTCACTGGCATTCTGAAAACTTTTTTAAGGGAGCTCC
      CCGAGGCCCTTTTCACGGATCAACTTTATCCACGATTTTTCGACACATTCAGCGCCTTTAGCAACAACAACGAATCCACA
      CGAATCAACGAGCTTCTAAAAGTTTTTGAGGAGTTGCCACAGGCCAACAAAGCCTCCATTACTTCGATATTAGATCATTT
      AATAAGAGTCCACGAAAAGGAGACAGATAACAAGATGTCGTTGCACAATCTGGCCATGGTGTTTGGACCAACCTTGCTAA
      GGCCGGGCCAAACGCAGGTGAAGCAGAAGGATCCACTGGCAGCCAGCACAGTCGACGTTATGGCTCAGGCAGGAATCCTA
      TACTGCTTTCTTCAGGCACGGATCAAGAAGGATTAGGATTTCGTGAGCAGTTTACACAGATACATATGGACATATATATA
      TGTACAAAAATTATATTTTTTACAAACAATAGCAATAATACGATGGAAGTTGATGGACAGTCTACTCATACGTCACGTCT
      CTATCTTAATGACAACCCCTTATATTATATAACAAACCGCCCAACTACCTTGAAACTACGGAAAAGGCCATTAAATTCCG
      AAAACACCATAAAACACTGGTGCTGCCTACTGTATATACCAGAATCCGCAACTGCAATTATAAACCGAATATGATGATAT
      GACGTGGAAAAGGGAAACACCAGGATCTATGTAAGGATCCAGGGATGTCACATATCAGCTCAATGTCGGGTCATCCATGT
      ACATCGCACACCTGGAACTAGCAAGTGTTTAACACTTGTACATCGCTGCTTCTCCGTTACTGAAAATTACTCCCATATAT
      TACCCGTACTTTACTAGACATGTACATTTGGATGCAAGTTCTGCTTACCGTAACAAGTGCAAAAAAGAGCAACAGAAAAA
      TTGCAAATATTTTCAACAATTAAAATATATATCTACAAACAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0112920
      5012
      FBtr0302200
      4254
      FBtr0340053
      5083
      FBtr0340054
      5089
      FBtr0340055
      3824
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0111832
      1403
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0111833
      1403
      FBpp0291410
      903
      FBpp0309060
      1402
      FBpp0309061
      1404
      FBpp0309062
      903
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RhoGAP1A-RA
      Secondary FlyBase IDs
        References (0)