Open Close
General Information
Symbol
Dmel\ACC-RC
Species
D. melanogaster
Annotation Symbol
CG11198-RC
FlyBase ID
FBtr0113053
Feature type
Associated gene
Evidence Rank
Length (nt)
7950
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 46 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGTTGAGTTCCAATCGTCGGTCACTGCAGTAGCCATCTAGAAATCGTGCGGAACCAGTCAGTCTAGGAAGTTCAAACCG
          ATCCTACACGGTCTACTACAATCCGATCCGATCCGGTCCGACCTCGTCTTCGAAACTGCCATCACAAGCTAAACAAGGGC
          ACACGCAGAGTGGTAAAGCGAGCTGAAACCGTAGATCTAAATCCTAAGACGAACTAAACCCAAAACACAACCGTATCATA
          TCCAGCCAAGGTCCCGAAAAGTGCTGCCCTAGAGATAATCGCACGTCGAACAACTCCAGCGTGATTGCAGCTACAGCAAC
          GGCAACAACCACCAGCAGCAAGCCTCCTATTGCTCCAGCAGCACCTCCTTCGGCGGTAAAAGCGAGTGACAAGCGATTCC
          CCAAGGCGTGCATCAAGAAGGTCCAGTTCTCCAGCGAGAGCCTCCGGTCCGACGTGGATGAGCTGTGCGACCAGCTGAAG
          GATAGCGCACTCAGCAATCTGAGCAACGACAACATTCGCATTGCCTGCCACCAGAACAACAACAACAGCAGCATCAACAA
          GAACCAGAACAACAACAGCATCGACATCAGCATCAGCATCAGCAAGATGAGCGAAACAAATGAGTCCAATGACACGGCCG
          CCCAATCCGCCGAGGGCGAGCGGCCCAGCTTTTTGGTGGGTGATGAGATCGACGAGCGGGCCGCCGAGGCGGGCGAGGCA
          TGTGACGAGTTCCCCCTGAAGATGCAGAACGATGTCCGCCAGAATGGCGATATTTCCGAGCGGCGCAAGCGGTTAAGGCC
          GAGTATGTCGCGTGGCACAGGGCTGGGCCAGGACCGGCACCAGGATCGCGACTTCCACATCGCAACCACCGAGGAGTTCG
          TGAAGCGCTTTGGCGGCACCCGAGTGATCAACAAGGTCCTGATTGCCAACAACGGTATCGCGGCCGTCAAGTGCATGCGA
          TCCATCCGGAGATGGGCGTACGAAATGTTTAAGAACGAGCGGGCCATTAGGTTTGTGGTGATGGTCACTCCGGAGGATCT
          AAAGGCGAATGCCGAATACATCAAGATGGCGGATCACTATGTGCCCGTGCCCGGCGGATCGAACAACAACAACTACGCCA
          ATGTCGAGCTCATCGTGGACATTGCTCTTCGCACCCAAGTGCAGGCCGTGTGGGCTGGTTGGGGTCATGCCTCCGAGAAC
          CCGAAGCTGCCGGAGCTGCTTCACAAAGAGGGTCTGGTGTTCCTTGGCCCTCCGGAACGTGCCATGTGGGCGCTGGGCGA
          CAAGGTGGCCTCCTCTATTGTGGCCCAAACGGCCGAGATTCCCACCCTGCCGTGGTCCGGTTCGGACCTGAAGGCCCAGT
          ACAGTGGCAAAAAGATCAAGATTTCCAGTGAGCTCTTCGCCCGAGGTTGTGTGACCAATGTGGAACAGGGTCTGGCCGCA
          GTTAACAAGATTGGCTTCCCCGTAATGATCAAGGCCTCGGAAGGAGGTGGTGGCAAGGGTATTCGCCGCGTGGACACCAC
          TGAGGAGTTCCCCGGCCTGTTCCGCCAGGTTCAAGCTGAGGTGCCCGGCTCACCGATTTTCGTGATGAAGCTGGCCCGCG
          GAGCTCGCCACTTGGAGGTGCAACTGTTGGCAGATCAGTACGGCAATGCCATTAGCTTGTTCGGCCGTGACTGCTCCATC
          CAGCGTCGTCATCAGAAAATTATTGAGGAAGCTCCTGCCATCGTGGCCCAGCCAGAGGTGTTCGAGGACATGGAGAAGGC
          CGCCGTGCGGTTGGCCAAGATGGTGGGTTACGTCAGCGCGGGAACCGTGGAGTACCTATATGATCCGGAGGGTCGCTACT
          TCTTCCTGGAGCTGAACCCACGTTTGCAGGTGGAGCATCCGTGTACGGAGATGGTGGCCGATGTAAATCTTCCAGCTGCT
          CAGCTGCAGATTGGAATGGGAATTCCCCTTTACCGGCTCAAGGACATCCGTCTGCTGTACGGAGAGTCTCCCTGGGGCTC
          CTCAGTCATTGACTTCGAAAATCCACCGAACAAACCGCGTCCCTCCGGACATGTTATCGCTGCTCGTATCACCTCAGAGA
          ACCCCGACGAGGGCTTTAAGCCCAGTTCTGGAACCGTTCAGGAGCTTAACTTCCGGTCGAGCAAAAATGTGTGGGGCTAC
          TTCAGTGTGGCTGCCAGTGGAGGATTGCACGAGTTCGCGGATTCACAGTTTGGGCATTGTTTCTCCTGGGGCGAGAACCG
          TCAACAGGCTCGAGAGAACCTGGTGATTGCCCTGAAGGAGCTGTCAATTCGAGGTGATTTCCGAACCACAGTGGAATACT
          TGATCACTCTGCTCGAAACGAATCGGTTCCTCGACAACAGCATCGACACCGCCTGGCTAGATGCCTTGATCGCAGAGCGT
          GTGCAATCCGAGAAGCCGGATATCCTGTTGGGCGTAATGTGCGGATCGCTGCACATCGCAGATCGTCAAATTACTGAGAG
          CTTTTCCAGCTTCCAAACCTCTCTGGAGAAAGGTCAGATCCAAGCAGCGAACACGCTGACGAACGTGGTGGATGTTGAGC
          TAATCAACGATGGCATCCGTTACAAGGTGCAGGCCGCCAAGAGCGGAGCCAACTCGTACTTCCTGCTGATGAACAGCTCG
          TTTAAGGAGATCGAGGTGCACCGCCTCTCCGACGGAGGCTTGCTCATCTCTTTGGAGGGCGCCTCCTACACCACGTACAT
          GAAGGAGGAGGTGGATCGCTACCGCATTGTGATTGGCAACCAGACATGTGTCTTTGAAAAGGAGAACGATCCATCGCTGT
          TGCGCAGTCCGTCTGCGGGAAAGCTCATCAACATGATTGTGGAAGATGGCGCTCATGTAAGCAAGGGCCAGGCCTATGCT
          GAGATTGAGGTGATGAAGATGGTGATGACCCTGACGTCCCAGGAGGCAGGCACAGTGACATTTGTGCGTCGACCAGGAGC
          TGTTCTAGATGCAGGATCCCTTTTGGGCCACTTGGAGCTGGACGATCCATCGCTGGTGACGAAAGCGCAGCCCTTCAAGG
          GACAGTTCCTGCAGCCAGAGAACGCACCGGTACCCGAGAAACTAAACAGGGTGCACAATACTTACAAGAGTATCCTTGAA
          AACACACTGGCTGGTTACTGCCTGCCAGAACCGTTCAATGCACAGCGACTCAGAGACATCATCGAAAAATTCATGCAAAG
          CTTGCGTGATCCCTCGTTGCCGTTGTTGGAGCTGCAAGAAGTTATCGCCTCCATCTCTGGTCGCATACCCATATCCGTGG
          AGAAGAAGATCCGGAAACTGATGACGCTGTACGAGCGAAACATAACTAGTGTCCTGGCCCAATTCCCCTCGCAGCAGATC
          GCCAGTGTTATTGACAGCCATGCGGCCACGCTGCAGAAGCGCGCTGACCGTGATGTCTTCTTCCTGACCACCCAGAGCAT
          TGTGCAGCTGGTGCAGCGCTATAGGAACGGAATCCGCGGCAGAATGAAGGCCGCCGTTCATGAGCTGTTGCGTCAGTACT
          ACGATGTAGAGTCGCAGTTCCAGTATGGACACTACGACAAATGCGTGGGACTGGTGCGAGAGCACAACAAGGACGACATG
          CAGACGGTGGTCAACACCATCTTCTCGCACTCTCAGGTGGCCAAGAAGAATCTGCTGGTCACTCTGCTCATTGATCACCT
          GTGGGCCAACGAACCTGGACTAACGGACGAATTGGCCAACACGCTAAGTGAATTGACCTCTTTGAATCGAGCTGAGCACT
          CTAGGGTTGCCCTGCGGTCCCGCCAAGTTCTGATCGCTGCCCACCAGCCGGCTTATGAGCTGCGCCACAACCAAATGGAG
          TCGATCTTTCTCTCCGCCGTTGACATGTACGGTCATGACTTCCACCCCGAGAACCTGCAGCGCCTGATTCTGTCGGAGAC
          CTCAATCTTTGACATCCTGCACGACTTCTTCTACCACTCTAACCGGGCAGTGTGCAATGCTGCTCTGGAAGTCTATGTGA
          GGAGAGCTTACACATCCTATGAGCTGACCTGCTTGCAGCATTTGGAACTCTCCGGTGGCCTGCCGCTGGTGCACTTCCAG
          TTCCTCCTCCCCACAGCTCACCCGAACAGACTGTTCTCGCGCATGTCCTCCCCCGATGGATTGGATCAGGCAGCGGCAGA
          GTCTTTGGGAAACTCATTCGTGCGCACCGGAGCGATTGCAGCCTTTGACTCCTTCGAACACTTTGAGATGTACTCGGACG
          AGATTCTGGATCTGCTCGAAGACTTCGTCTCGCCAGCCATGGTTAATGCCAAGGTCCTGGAAGCCGTAGAGGCAGCGGAT
          TCTATCTCGGACAGCCGACACAGCACCTCGATCAATGTGTCGTTGTCGGATCCCGTAACCCGGGCGAATGCTGCCGAGGA
          GGCCAAGTCCACCGAACCGATTCACATTGTTAGTGTGGCTGTGAGAGAAACGGGGGAGTTGGATGACCTGCAAATGGCCC
          AAATCTTTGGAAATTATTGCCAAGAGCATAACGAGGAGCTCTTCCAGCGACGCATTCGTAGGATTACATTTGCTGCTCTG
          AAGAAGCGGCAATTCCCCAAGTTCTTTACGTTCAGAGCCAGAGATAAGTTCACGGAGGATCGTATTTACCGGCATCTGGA
          GCCAGCATCTGCTTTCCATCTGGAGCTGAACCGCATGAAGACGTACGATCTGGAGGCTCTGCCCACGGCTAACCAAAAGA
          TGCACCTGTACCTTGGCAAGGCCAAGGTTTCGAAAGGTCAAGAGGTCACGGACTACCGCTTCTTCATTCGCTCGATCATC
          CGTCATTCGGATCTGATTACCAAGGAAGCCTCTTTCGAGTATCTGCAAAACGAAGGAGAGCGTGTGCTCCTGGAGGCCAT
          GGATGAGCTGGAGGTGGCATTCTCGCATCCGCACGCCAAACGCACGGACTGCAACCACATCTTCCTGAACTTTGTGCCCA
          CCGTCATCATGGATCCGGCTAAGATCGAGGAATCTGTAACAAAGATGATTATGCGATATGGTCCACGTCTTTGGAAGCTG
          CGTGTACTGCAGGCTGAGCTCAAGATGGTCATCCGCCAGTCACCACAGTCACCCACTCAGGCAGTGCGTCTGTGCATTGC
          AAATGACTCCGGCTACTTCCTGGATATTTCGATGTATACCGAACAAACAGAACCAGAGACAGGAATCATTAAGTTTAAGG
          CCTACGGTGAGAAGCAGGGATCTCTGCACGGACATCCCATTTCGACGCCCTACATGACCAAGGACTTCCTGCAGCAGAAA
          CGTTTCCAGGCGCAGTCCAATGGTACCACCTATGTCTATGATGTGCCCGACATGTTCCGCCAGATGACCGAGCGTCACTG
          GAGAGAATTCTCCAAGGCTCGTCCCACCGTGGACATTCGCACTCCCGACAAGATTTTGATCGAGTGCAAGGAGCTGGTCC
          TCGAGGGCGACAACCTTGTAGAGATGCAGCGTCTGCCCGGCGAAAACAATTGCGGCATGGTGGCTTGGCGCATTGTCTTG
          GCTACTCCGGAATATCCGAATGGCCGCGAGATCATTGTTATAGCCAACGATCTCACCTACTTGATTGGTTCCTTTGGAAT
          TAAGGAGGACGTTCTCTTTGCCAAGGCTTCCCAATTGGCTCGCCAACTCAAAGTACCGAGGATATACATCTCCGTTAACA
          GCGGTGCCCGCATAGGACTTGCTGAGGAGGTTAAAGCTATGTTCAAGATCGCATGGGAGGATCCAGAGGAGCCAGATAAG
          GGCTTCAAGTACCTCTACTTGAGCACCGAGGACTACGCCCAGGTGGCCAACCTGAACTCGGTGAGGGCTATCCTGATCGA
          GGACGAGGGCGAGCAGCGTTACAAGATTACCGACATCATCGGCAAGGACGATGGTCTGGGCGTGGAGAATCTGCGTTACG
          CCGGCTTGATTGCCGGTGAAACGTCGCAGGCCTACGAGGAGATTGTTACTATCGCTATGGTTACCTGCCGTACCATTGGC
          ATTGGATCCTATGTGGTGCGCCTGGGTCAGCGCGTTATCCAGATCGATAATTCACACATTATACTCACTGGCTATGCTGC
          GCTTAACAAGCTGCTTGGACGCAAGGTGTATGCCTCTAATAATCAGTTGGGTGGCACACAGATCATGTTTAACAACGGAG
          TCACCCACAAAACAGAGGCCATCGACTTGGACGGTGTCTACACCATCCTCGACTGGCTCTCGTACATCCCCGCGTACATC
          GGTTGTGACCTGCCCATTGTTTTGCCCAACGATCGTATCGAACGCCCTGTCGACTTCATGCCCACCAAGTCGCCCTACGA
          TCCGCGCTGGATGCTGGGTGGCCGTGTGAATCCCGTGAACGCTAATGACTGGGAGAACGGATTCTTTGATCGCGACTCGT
          GGAGCGAAATCATGGCCTCGTGGGCCAAGACAGTGGTCACTGGTCGCGCACGTCTAGGCGGTGTCCCCGTGGGCGTAATA
          GCCGTTGAGACCCGCACCGTAGAAGTGGAGATGCCCGCCGATCCTGCCAATCTCGATTCGGAAGCCAAGACCCTGCAGCA
          GGCAGGTCAGGTGTGGTACCCCGACTCCTCGTACAAAACGGCACAAGCGATCAAAGATTTTGGACGAGAGGAGTTGCCGC
          TGATTGTTTTCGCAAATTGGCGAGGCTTCTCCGGTGGCATGAAGGACATGTACGAGCAAATCGTCAAGTTCGGAGCATAC
          ATTGTCGACGGCCTGCGGGAGTACAAGAAGCCTGTGCTCATCTACCTGCCGCCCAACGCCGAGCTGCGAGGTGGAGCCTG
          GGCCGTGTTGGATTCCCTCATTAACCCGCGCTACATGGAAACGTATGCCGATCCGGAGGCCAGAGGAGGAGTTCTCGAGC
          CGGAGGGCATTGTGGAAATAAAGTACAAAGAGAAGGACCTGGTCAAGACGATTCACCGCTTGGATCCGACCACCATTGCG
          CTGAAAAAGGAGCTCGATGAGGCAAATGCGTCTGGCGACAAGGTCAGGGCTGCTCAGGTGGACGAAAAGATCAAGGCCCG
          CATCGCTGTGCTAATGCACGTCTACCACACGGTAGCAGTTCACTTTGCCGACCTGCACGACACGCCGGAGCGAATGCTAG
          AGAAGGAGTGTATCAGTGAGATTGTGCCTTGGCGCGATTCCCGCCGCTGGCTGTACTGGCGTCTGCGACGTCTCCTGTTG
          GAGGACGCATATATTAAGAAGATCCTGCGCGCTCAGGACAACCTCTCCGTGGGTCAGGCCAAGCAGATGCTGCGTCGATG
          GCTGGTAGAGGAGAAGGGTGCCACAGAGGCTTATCTGTGGGACAAAAACGAGGAGATGGTGTCTTGGTATGAGGAGCAGA
          TCAATGCCGAATCTATTGTTTCCCGCAACGTGAACTCCGTGAGACGGGATGCCATTATTTCTACCATTTCGAAAATGCTC
          GAGGACTGTCCCGACGTAGCGCTGGACGCTGTTGTGGGTCTTTGCCAAGGTCTGACGCCAGTGAATCGAGGCGTGGTCGT
          ACGCACATTAGCCCAGATGCAGCTGAATGAGGAGACCTCTAACAGCAACCAGGGATGATTCTACGCTATGTTCTAAGTTC
          TTTTTAGGCCCTCTATTTCATCCTTCCCGTTCCCGCCCTTCACCACATTTCTCAGTCCCGCTTTGCGCTTGTAAGATATC
          GCAAGGCGTGCATGATGTGCATTTTGTTTAGTTAAATTTGTTTAAAAGTAATTAGCGTAAATCTAGTTATGTATTGGAGT
          TGTAGGCATGGGTTAATTTGTTGCCTAAGTGGCCCGATAAACTAGTTGTATCGTGTACATATTTGATTATGTATATCCCC
          TGAATACAAATCATTCCATTAGTTGTATAAGAACTAAAGTCCTTTGTACACAGAGCCTTTTGAATAATACGAGTTACTGA
          AAAAATAAATGTATGGTACACTACATTAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0088871
          8010
          FBtr0088872
          7833
          FBtr0339123
          7741
          FBtr0339124
          7860
          FBtr0339125
          7814
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0111966
          2323
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0087947
          2482
          FBpp0087948
          2323
          FBpp0308268
          2348
          FBpp0308269
          2323
          FBpp0308270
          2323
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          ACC-RC
          CG11198-RC
          Secondary FlyBase IDs
            References (0)