Open Close
General Information
Symbol
Dmel\Xrp1-RE
Species
D. melanogaster
Annotation Symbol
CG17836-RE
FlyBase ID
FBtr0113246
Feature type
Associated gene
Evidence Rank
Length (nt)
2030
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 79 )
Sequence
TCATTTCTGTTCGCCACTAGCAGCCGTTCAAAACGTAGTGAATACTCCAAGCAGTCGGTTGACTCAGAGATCGCACAGTG
AAGTTAGTTCTATAAAATACATATAGAATACATATAACCAAGGAAACCCAGTGTAAAGACTTGGCAATCGTTGTTGTTCA
TCGCGGAACAATAACAGTGGACATTTGTCGCTATCCCAGAAAGTAATCCTTTATATCCGAGCAACGGCCGGACTTGAAGC
AATACACAAGTGGTGGTGCCAGGAACCACCCAACCTATTGCGTAGCAGAAAAGACAAGTGAATTCGCGGTCGGGTTTTCC
AAAAAAACCAGACCACCAATCTTGAAGACACATTTACCGAATTGATAATACCTGCAAGACATAGAAGCAACGTCATCGAC
GTGCAACAGCGAAAACGGAAAGGAGATTTTTACTGAGACGGATATTCTTGACTTTGATATAAACATGTTTGCCGAGGAGG
ATCTGATTGAGCTTGAGGGCAAGAAGACGGATCCCTTCAGTCCGGCAATGGACGGGATGAACAACGACAACCTAGACGAC
GACTTTCTACAATTGAATGACCTGCTTAACGAGGAGGAGACTTTCGACATGTCATCGATGTCCGGCGTCGGTATCGACAT
CAACCAGGAGCAGGAACTGGACTTCATCAACATATTCCACAACTCGCAGCCAACGGCCATGCTCACCAGCTCAGAGGACC
CCTATCTCGCCACCTACTCTCAGGCCACATCCACATCCAGCACCACCAAATTCATCACGGAGGAGCCCCTGCTCGCCGAC
ATGACCAGCTTCGACATCAGCTATACCAGCAGCCAGGAGCTCGGCTTCGGCCTTGTGGAGGACGTCAGCGGCAGTTTTGC
CAGCAGTTGCAGTGACGTCGCCGCGGCCATCCCAGCCCCCATCCAACACCCCATCATTACCAACATCAAGCGTTCTGCTC
CGGCCCCGGTCGAGTCGCAGCCCACCAAGCGCAGCCGACTGATGCTCCAGATCAAAACCGAGCTAGCTCCAGCATTCAGT
CCGACCACACCGGAGATTATCAACCAGCTCCTGAATGATGATCGGTTCGAGGCTCCCACCACAAGTACCAGTACCAGCAC
CAGCAACACTTCCATCAGCAGCAGCACCCATGCAGACATCGTAGAGGATCTACGCAGTGCCGAAGAGGAGACTACCACCG
ACTTCTCGGCGCCGAACACACCACACAGCAACTACTCAGCCAGCTCCAGCTGTGCGGCGCCCACCTGCCAGACCGGCTAT
GGTGGCTTCCTCACTGCTCCCACCTCGCCCGCCTATTCAACAGCCAGTACGTCCGTGTTCAGCCCTTCGCCAGCCAGCGG
AATCAGCGGCAAGCGGAAGCGCGGTCGCCCTGCCAAGGATCATGCCGACGGTCCCGATCCCGTGCTCATGTCAAGCATGA
AAAGCGAGGAGGAGAGGAAGGCCTACCAGGACAGACTCAAGAACAACGAAGCGAGCCGCGTATCGCGCCGGAAGACGAAG
GTGCGCGAAGAGGAGGAGAAGCGCGCCGAGGACACGCTATTGGCCGAGAATCTGCGACTGCGTGCCCGGGCCGACGAAGT
GGCCTCCCGGGAACGGAAGTTCAAGAAGTACCTGATGGAGCGCCAGCGGCAGAAGAGCACTTACGTTAAGCAGGAGCAGG
ACTGAGATTCTCGTAGCCATAGAATAGAAATTGCGGAGCATAAGCCTGTCATAGTACCTATCGTCGTCATCCAATTGTTT
AGTTAGTTAAGTTGTCGTTGAAGAAGTCGAGAAGCAGAAATCAAATTTCCATTTCCATGTGGACATCAGTTAAGCCACTT
ATTAGGCATAGTGATGGCGCCCATAGTGCGCGAGGAGTGTTTAACTTTAATTTTACTTTTATTATGTTTGAGAAAACTAA
AAAATTTTTATACCCACGGATATGTTTTTCGTCCAAAGCGTAATCAAAAAAAAAAAAAGCACAACAAAAAAATGATTACG
AGTTCGTATGTTTTAACCCCATTGATGAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0083701
3027
FBtr0083700
3619
FBtr0083702
2120
FBtr0083703
1740
FBtr0334523
3196
FBtr0334524
3167
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0112158
406
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0083115
668
FBpp0083114
668
FBpp0083116
406
FBpp0083117
406
FBpp0306590
668
FBpp0306591
668
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG17836-RE
Xrp1-RE
Secondary FlyBase IDs
    References (0)