Open Close
General Information
Symbol
Dmel\Ttd14-RC
Species
D. melanogaster
Annotation Symbol
CG30118-RC
FlyBase ID
FBtr0113361
Feature type
Associated gene
Evidence Rank
Length (nt)
2584
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 67 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAGTATAAGACCCCGTCGGCACAGGTATTCCACAAGATTCTGTTATTCGCTTGTGTAATTAACGGATGCGGTGTCAACT
        AGTAAAAATGCAATACCATCCCAAGTCGAATAAACTTTGATATTGCCCAAACAATCGAATGTGGTACAGATTGTGAAAGT
        AGCGTGCAACGCTGCCGTCTACTTAAACTTGTAAAGTTCCTCCTGCTCCGTCATCAGACTTTCTGATAGCATCCCGCGCA
        ATCCAAATTCTGGGAATGATTTCAGCGCGCCAGTGCGTCATTTAAATTGCAAAGCGCACGAGTCCGAGCCACCAGCTGGA
        TCTCCAGGATTCATAGACCAGGATCGAGACCAGGTCGGCAGAAAAGCACGAGGAGCCACAGGAGTTGCCCGAGTTCCACA
        GGCATAACCTTAAACGGCACGTGCACCGCGCGTAGAAGAGTTCTCTGCGTGCCACCACACAGCGAATCGGTTGCTCTCCC
        AAAAAACAAACACGCAATACCAAATTCCCGAAGTCGAAGACATGGCCACCCTCCTCAGCAACGGACAGCAGTCGGTAATG
        GCCAGCACCAGTAATGGTCAGGAGCAGCAACGGCACCAGGACGAACCGGAGCAGCAGCAGCAGGTCGAGATCAGAAAGTC
        GAGCTCACCGAAACCAGGCGCCATGCCCAGCTTGAAGCTGAACAGAATGGGTTCGGTGTCACCGAAAGATAAACGAGTCT
        ACAAAATCGTCCTCACTGGCGGGCCTTGCGGCGGAAAGACGACGGGACAGTCCCGCTTGTGCACTTTCTTCGAAAACCTT
        GGATGGAAGGTATTCCGCGTGCCTGAAACGGCCACTGTTTTACTCAGTGGCGGTGTGAAGTTCTCCGATCTGACCGAGAA
        AGAGGACCCGCCCACGCCAACCACGTTCGTTTACAAAGATCTGCCCTTCGCCGCTCCGGAGCACAGTCTCATCGATCTAA
        CCGCATCCTGTCCGCGCTGCTTGGCCAAGGCTGCATCCCGGCCCAATGGCAGCGAAGCCTACAAGTTCCAGGAGAATCTG
        ATCCGCACCATGGTTCAAATTGAGAACACCTACTTTGAGCTGGGCAACTCCAGCAATCGCAACTGTCTGATAATCTGCGA
        TCGCGGCGTTATGGATGCCAGTGCATACATATCCAAGGATAAATGGGAAAAGATGATGGCGGGCAATAATTGGAATCCCG
        TGGAGATGCGCGACAATCGTTACAACCAAATCCTGCACTTGGTTTCGGCTGCCAACGGCGCCGAGGATTTCTACTCCACA
        GAGGACCATGCCTGTCGCTCGGAGGGCGTTGATTTGGCCCGGGAACTGGACTACAAATCCGCCGCCGCCTGGGTTGGCCA
        TCCCTACTTCGATGTGATCGACAACTCCACCAACTTCGAGACCAAGATGAATCGCATGATTGAGTCGGTGTGCCAGAAAT
        TGGGCATTGATATTGGCGACCGTTTGCAGGCCACGTCGCGCAAGCTGAAATATTTGGTGGCCCTTTTGCCGCCGGACAGC
        GAGTTTCCGCCCTTCCAGGATTTCGATGTCGTACATCATTATCTGCAGTCCGCCGGACCCAAGGTGCAGGCTCGCCTTCG
        CAAGCGTGGACAGAAGAACCACTGGAGCTACATCCACACGCAGCGGCGTCCAAACGTTCACGGGCAGGCCCGCATTGAGG
        TGAAGACCCAGCTGACGCATCGTGACTACATGAACTTGCTGGCCCAGCGCGACGATGCTCACTTCACCATCTACAAGAAG
        CGCCGCTGCTTCCTTATCAACAACCAATATTTTCAGCTTGATATTTATAAGGAGCCAGGCCACCCACGCTGCAAGGGATT
        GGTGCTTTTGGAGACGTATTCGTCACTCACCGGCGATGCCCTGAAGAACTGCATGCCCAAGTTCCTGAACATTGTAAAGG
        AGGTGACCGGCGATCCGGACTACTCCATGTTTAATCTATCCCTCAAGGAGGACTGGAGCACCACGAAGAAGTTTTGCCGA
        TCGGCGACGCACGTTAAGGGCGCCGCTAATGGAGTCTCGAGCACGCCGCTGCTCCTCAATGGTCAGTAGGCTTCCGAACT
        GTCCCTGAATCTCTTTTGCACACGCATATTACACGGCAAAAGCAAATTATAAGAACACCAATGACCTGGCAATGAAATGT
        ACAAAACAAAAAAAATTTTAAAACCGGAACGGATGTCGTTCCAAGCCAACAAGCAATCAGTGCTCTGGCCCCCCAAAACT
        ACCCCCCTAAAACGTCCACACACCCTGTTACTTATTTGCGTACTTAACCGCAGGAGGATGAAGGAAGCGTAAACTCTAGA
        GGCGTATGTGTCGAGTCTATAGTTTGTAGCTTAATCGCAACCGGAGGTTGGGAGCCCCACCAGTACTTAAATTTTCTTGT
        CATGTTTGCTCGTGTTAATTTTGTAAGCCATACCCACTAGTAACTATGTAAATCCATGGATCCGCGATATCATATGACGT
        TTTTGTGTCTTTTGGAAAATTTGTGAACCCAATCATTTTAACTAAATAAGATTACAACTACAAGACCACCAAACAGTTGC
        ATTTTCTTATTACGTGTTTGTGTA
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086724
        2317
        FBtr0113360
        2030
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0112273
        515
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085903
        475
        FBpp0112272
        471
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG30118-RC
        Ttd14-RC
        Secondary FlyBase IDs
          References (0)