Open Close
General Information
Symbol
Dmel\CG30424-RC
Species
D. melanogaster
Annotation Symbol
CG30424-RC
FlyBase ID
FBtr0113376
Feature type
Associated gene
Evidence Rank
Length (nt)
865
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACAACGATATGGTAAGCACTATGAAGCACTGACATCTAAAATCTTTGAAATACTGAGAAAGGAGAATCCAGAGCTGGACA
          TCATTATTGCTGAGTTCAGTTTGGAAGGAACCAGAGTCCTACTGGCTGAATCCGCTCTCATTCATTTTAGCCGATATGTT
          CGACGACTTGGCGGAGAACTTAAGGCGGGGAGTTATTACCTTTTTTTGGGACCCCGAGCTGAACATGATCGACGCATTGA
          CCCGGGATCAAGTTTGGGAAATGTACCTGTGCGTGCAAAGGATTCCAAGAGACCTGAGGGGCGCAGAGATCAGCCGGAAT
          AAATGGAGTTTTTTCGTACTTCGGGAATTCAGTCACAAAAAGGAAAGAAATGTAAATCTAAAGTGCAGCTCTAGGCGAAA
          ACGAAATGTTATTAAGGGACTGAAGACCACTTCAATTTGCAAGCTAAGAAATGCTCGAACTAACGGTACCTGGACTGCTG
          GACTTTGGACTCGACCCGGCCATGCGTACAGAGGCCCATCGGAAACGGTGTCGACTTGGGACACAGTAAAGGACGCAGCG
          TGGTCAGAAGGGATTGTGGAGTAAGTGGATAGTGTCCTGCGACACGAGCGGTCCTAACAGACGTGCGCTTCCGGGTGGTT
          GCAAAGGTGGTTCTGGGAAGAGCATTGATTCGCAATAATGGAAGTTCTCTAATCTCAGTGCAATTTACATATGTACTCTC
          CAGCAATTGTTGAATGCACTTTAGTAGTAATAAGAGGAAAATTAAATGGCACGCTCTATTTTTTGCCCAAGTTATGTTAC
          AACAATCTATATTGATAATTTGGTGCAAAACTAAAAAAAAATAAAACAATGTTGAATATTTTGCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0113375
          910
          FBtr0113377
          1713
          FBtr0343511
          946
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0112288
          142
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0112287
          176
          FBpp0112289
          389
          FBpp0310116
          188
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG30424-RC
          Secondary FlyBase IDs
            References (0)