Open Close
General Information
Symbol
Dmel\rl-RA
Species
D. melanogaster
Annotation Symbol
CG12559-RA
FlyBase ID
FBtr0113701
Feature type
Associated gene
Evidence Rank
Length (nt)
1412
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATATTATTAATGTTTTACGCCGTCGATTTTGATAAATCATATTTACGCATTTGTCTAAAGAGTAAAAAAAAGTTGAGTTT
      ATATATTCATATCTTAAGTTATAGACTTTTGGTTAAATTCATAATAAAGTAAATAAAGATTTTGCACTTATTGCTGTTCA
      CTTAAATAAGATAAAGTGGGACATATTCAGTTGTAAAAGTGTTATTACAATCCACGCATACATACATTGCGAATTTTGCA
      GATACGGTGTATTTTGTATCATAACATCTTTAGTAGTATTTCAAGTTTTCCAGAAGAAACGTTAGTCATGGAGGAATTTA
      ATTCGAGCGGATCAGTAGTTAATGGTACAGGATCTACGGAAGTTCCTCAATCTAATGCTGAAGTTATAAGGGGACAAATA
      TTTGAAGTTGGTCCTAGGTATATTAAACTCGCCTATATAGGTGAAGGAGCTTATGGCATGGTTGTGTCTGCGGATGACAC
      GCTAACAAACCAAAGAGTTGCAATAAAAAAAATATCGCCCTTTGAACACCAAACTTATTGTCAAAGGACTCTCAGAGAAA
      TAACCATATTGACCAGATTTAAACATGAAAACATTATTGATATTCGAGATATTCTTCGAGTTGATAGCATAGACCAAATG
      AGAGATGTTTATATTGTACAGTGTTTGATGGAGACTGATTTGTATAAACTACTTAAAACACAGGTAATGGTGCTCCCTGA
      TATTTGGTTAAAATTTATTGAAAGAATAACTACCATTGATATGTGGTGTATTATCTTGGCCATTACTCCAAATACCAAGA
      CTGAGTACAATTGTAGGTTGTCGGACATTTTCAATTATGGAAGTGATTCGCGTTATGCTTTCATGCGGGCTTTAAAATGA
      TCTGATCAATGTTTAAAGAAGAATGTGGATATTCTCTTTTTAACTATTTTTACCAGAAATAACTATACTTTAACCTATAA
      TATCTTTATAAAAAAATAATAACCATAATCAATGGTAAAAGAATGTTAGTCACACATAATTTAAACAGCTTAAGAAGAAA
      TTTAGCATAAGAAACTGTAAGAGATCTAAGTGTGTGAAGGTATGCATATTAACATGAATTGAGAACGTTTATTTTTCTTC
      ACAAAACAGCAACACTGTCGAGCCACGCAGCCGGCATCATTAAACAAGACCAATTGTAAAAGTTATGGTTAACGTAAATC
      AGTCATTGTTTTCCTCTTGCTCATTTATCTAAGCAAACGTTTGCATACATACATTCTTATCTTTACGCTGAACTTTATAC
      GCAGCCAAAGACAGACAAATTCTCTCAGTTTTGAGGTGAGTTGTCTACATACGCCGCCTGAATATATACTTTTCTCTCTG
      GCTTGACCCTTTCGTTATCAAATAAACTAAAATAAACCAAGAATATTATCTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0113703
      1614
      FBtr0113702
      1795
      FBtr0113700
      1573
      FBtr0329919
      2347
      FBtr0329920
      6472
      FBtr0345337
      2072
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0112424
      190
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0112426
      376
      FBpp0112425
      376
      FBpp0112423
      376
      FBpp0302952
      331
      FBpp0302953
      266
      FBpp0311493
      376
      Comments

      Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      rl-RA
      Secondary FlyBase IDs
        References (0)