Open Close
General Information
Symbol
Dana\GF11518-RA
Species
D. ananassae
Annotation Symbol
GF11518-RA
FlyBase ID
FBtr0116218
Feature type
Associated gene
Evidence Rank
Length (nt)
3860
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            GTGCGAAGGAATTTTGACGTGTTAGTTTCCCATCGCGGTTAGAAAAGTAATACAACTTTTACAACGAACTGAATTTTCAA
            ATTGATGTACGATTAAAATTATCCCACAATAATTGCTCAATCTATTTTGTTTGTGTTTCCTTCCACTAAACTGATATTTG
            TGAACGGTAGCATATGAAAATAAGCAATAGTAGAGTGTATCCTGGGAATTTTTGGCAAACATATACAAGTGCATAAGAAA
            ATTTATATGTACAATGTACGTACATACATTGGATAAAATCATAACCGTGACTATTTTAAATGGCTTTAATATTTAATTAA
            ATAGCTTTAGTGACCAACGAAACTATTGTTGTTTAAATAATATCCAAAATATTCATAAATCTGAAGAAGTATACGCCACA
            ACTTCAAAATATATAAACCTATGTGTTATACATACCGTTATATCGTTACACATATATAATCGGGTGTTCATACAAGAGTG
            TTAGTGTCATCTCATCTTCCGTGAAAATTCAGTTGATAAAATGTAACTATTTCAATTCGAATTAAGAACTTAAATTGGTG
            TACTAGTGGATAATAGTGGAATTAAACTAAATGATATAAAAAACATTAAATAAATTAAAACCATGGAGTTGCTGCTACAA
            TTGCTGCTAGCAATTCAACTAATTGGCTTAAATCGTGGAAGTAAAGATGTTCCAATTCACCAAATTGAATCTTTGGTGGG
            GGAAAATATTTACCTTCCGTGTAATGTAACCACATATGATGGAGATGAACCTGTACTGGTTTTGTGGTACCGAGATGATA
            AGGGTACACCCATTTACAGCATTGATATACGTGCGGGAGTATCCAAAGCTCCGAAAAGATGGTCTGATGAGTCTGTCTTC
            GGAGACAGAGCTTACTTTATATTTGACAAGGAGCCGGGAAAACTTTCAATTCAAAATACACAAGCCTCTGACTCGGGAAC
            TTATAGATGTCGGGTAGACTTTCTAAAAGCCCAAACTATTAACAGCCGTGTTAGATTAAATGTCATATCTCCACCGAAGC
            AAGTTATTATTCGAGATAGTGCCAATGCGGAAAGGTCTACGGTGGTTGGACCTTATAGTGAAGGTGATATTGTATCATTA
            AAATGTCAAGTTATTGGAGGCTACCCTACACCCACAATCAATTGGTACCGTGATGGTCTAGAAATTCCATGCGAATTATC
            TCATTTGGCCGGGGGAAAGATCATTGAGTGTGAAATCACTCTTCCCTCATTGGGCAGAGAGGATTTGAATTCTAGGCTTA
            CTTGCAGAGCTGTGAGCCATCCTCGAGCTCCCATTGTTGAGGCAGTGGTTCAAATTGACATGAACTTTGCTCCACTTAAT
            ATTAGACTGCTGGGTGCCCACCAGCCCTTGTCTGCCGGTCGAAGATATGATCTTTTATGCCAAAGTGCCGGCTCTAGACC
            TCCGGCAGTAATCACCTGGTGGCAAAATGGCATAAGACTCGAGAAAACAACGGAAACTACTTCAAGTGATGGAAACCAGA
            CAACGAGCACTCTCTCAATAAGTCTGAGCAAATCTGATGCCGGAAAATATTTATCCTGCAAAGCCTATAATCATGCGGTT
            CCTTCCGATCCCCTGGAAGATGGATGGAAGCTCGACATTCAATATGTTCCCGAAGCCTATGTGCGTTTGGGGACTTCCCT
            AGACCCCAGCACTTTGCGGGAGGGAACTGATGTGTACTTCGATTGTCTGGTAATGGCTCATCCAAATGTCTTCCGCATTG
            AATGGCGCCACAATGACCAACCATTATACCACAACATTTCACAAGGCATCATAATAAGTAATCACTCTTTGGTCCTGCAA
            GGTGTTACAAGAGCCACAGCTGGAAACTATTCCTGTGTGGGCTTTAATGCTGAAGGCGAAGGAATAAGTGCTCCATTTCC
            TTTAAATATTTTGTATGCCCCCACGTGTGCACAGAATCAGAGGAAAGTCTATGGAATCGCCAAACAGGAAGATGCAAAAG
            TTATGTGCACAGTAGATGCTAATCCGCGGGAGGTTGAATTTAGCTGGACCTTCAACAACTCCGCCGAAAGTATTGATGTT
            GCCACAAATCACATAATGCGATCAGGAACCACATCAATTGTGACTTATACCCCGATTACTGAGTTGGATTATGGAACCCT
            TTTATGTCTGGCCTCAAATAAAATCGGGAAGCAACGAATTCCCTGTGTTTTCCACATTATAGCTGCAGGTCGTCCGGAAA
            AGGTACATAATTGTACGGTTACCAATATCTCCATGACATCGTTAACTGTGACATGTAGTGATGGCTTTAATGGAGGCTTG
            CCGCAAAATTTCAACATGGAATTACAGGACTCTTACACACAGGAACTTAAAGCCAACATTACATCGACATCTCCGCGATT
            TGCGGTTTCAAATCTCAGTCCTGGCAGCATTTACAGGATATACATTTATGCATTTAATTCGAAGGGCCGATCCGAGCCTG
            CTGTGATTAATGCTGCCATGCTGCGTATGCCCGAAAAGCAGCTAACATCGGAACAGACTAATAATCTTCGTGCAGAACTA
            TTATTTTCGCCGATGGTGTCATTAACCGTGGGACTTACCCTGGCCGTGTTAGTGGCAGTTCTGGCCATTATCCTGGCACT
            CCGAATTCCCTGCTCCGCCACGTCCCGACGCCGTCAAAAGGAACTATCAAACGAAAATATATCCAGAGATGATTCCCCAG
            GACCCAGCGACAAGAGCTCCGGCAGCAAGGAAGTGGACGACTGTGATGAAAAGAATCCAGATGTGGTGCCGGAAACTATT
            GAGCCCGATGATCCGGCTGAGAGTACCAGAAAACGGCAGCAAATATCAACTATAGATACAAATCGTAGCCCAAATAGGGG
            AATTTTTGTTAACGAGCAGCAACACTTGACCGCTGCAGAAATATCCTTGCGGTCATCTCATGGAATTGGTTATTGCACCC
            TGCGAGGTGGAATGCACGCCCAAGCCCAGAGCTCTGTTGGAGAAATATCTATTAACGTAACTCCCCATGTCTATTCCAAT
            GCGATCTCCCAATGCACTCTGCCGCGACAGTCCTCGCAGAATGTCTGGCCCAACTATAGTTGCACCATGACCGGAACAAG
            ACCCACCTCTACGTTCCACCAGTTGTCCTTCCCCCAGGGCAGAGTCAATGGCCATCAGCCGCCGCCACCCCAGCCCCTGC
            CCCTGCATGGACATGCCCCTTCACCGTCACTGGCGTCCAACAGCGGAGGCACCATCACCGCCACGCCAAATATGGCATTG
            CCCCCACAGAACCCACATGGCAGAACCATCGCCATGCACCACATGAACCAATCCCAGTGCGGCAGAGTCTGCATCGGAAT
            CGCTAGCGATGGCATCCACGCAGCCGAGCAAAACCTTTCCGACGACGAGGTCACCGTCCAAACTCCTTTAATGATAAAAC
            GCGACAGCACCGTATGACTATAGAAATTCCACAGGGTATTCGACACGCCCCTGTGATTAGGATTTAAATATTTTCTGTAT
            TCTGTATTCTGCATTTCGAAACTCAATAGAATAATCTTTTTATACCACTTTATTATTGACAACAATATTCTGGAGAGATC
            AATTATTTTCGGCCAAATATGAATGTTAGTTTTTAACGTTGATAATTATAAGTTATACGAAATCAATACTCACTGAAATC
            ACTTATAGGGTTTTAAATTTTTAATTACGCGAAAATGTGGCCAATGGAAATACTTTTACTGCAGTTTTTAAAAGATACCC
            TCTCTATACACTGGCATCAATTAATAGACTGAGTTTGATTTTAAATTTATTTGATTATTTCTCTTATAAATCGTTTTGTT
            AAAACTTGAAGATAATTCGA
            
            Other Products of this Gene
            Other Transcripts
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0114710
            944
            Derived from OTHER transcripts
            Comments
            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            GNOMON
            • Dana_gnomon_100_rna.8039626
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Secondary FlyBase IDs
              References (2)