Open Close
General Information
Symbol
Dana\GF14007-RA
Species
D. ananassae
Annotation Symbol
GF14007-RA
FlyBase ID
FBtr0118707
Feature type
Associated gene
Evidence Rank
Length (nt)
1230
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            AGCTGATCTGGCGCACCTTCTATAGCCATTATCTGGCTATACTGATTATACAGACCTCAGTCTCTCCTGCTGCGGCAAAG
            GGCAAAGGTTTTCCGATCCGATCCGATCTGATCCGACCTGCTCTCGTTTCGGTTTCCAGTCTCAAGATGACCTTCCTGGA
            GTTCCTGCTCTTCCTGCTAGTGCTCTACTATGTGGTCTATGTCCTCCTTTGGATCCTGCTCGACTGCAATGTGGCGCTGT
            GGTACAAGTCCCGGTTTGGGGCTTCCTTGTCCTCGATGCGCGGACAGGTGGTTTGGATAACCGGTGCCTCGAGTGGAATT
            GGCCGAGCCTTGGCCGTGAGCCTGGCCAGGCAGGGAGTGAAGCTGGTGCTCAGTGCCCGCCGAGTGGAGCAACTGGAGCA
            GGTGCAGGAGGAGTGCCTGGCCGCTGCCAAGGGGCTGCTAGCCACCAAGGATGTTTTGATTCTGCCCATGGATATGCTGG
            ATCTGGAGCAGCACCGAGTGCATCTCTACACAGTCCTTAACCACTTCGAACGCCTTGATGTCCTGGTGAACAATGCCGGC
            CGATCGCAGAGGGCCAACTGGACTGATATCGATATAGAGGTGGATCGGGAACTCTTCGAACTGGACGTCTTCTCGGTGGT
            CCATCTATCCAGGCTGGTAGTCCGGTATTTCGTCGAGCAGCGAGGAGGTCGTGGCCATTTGGCCGCCACTTCCAGCATTG
            CTGGCTTCAGTCCAGTGCCATTTTCGGCAACCTATTGCGCCGCCAAGCATGCCCTGAACGCCTATCTCCTCTCTTTGAAG
            GTGGAGATGCGGAAACTGGACATTACCATCTTTGCCCCAGGGCCCGTTGCCACGGACTTCCTCCAGGAGGCCTTCACCGG
            CTCCCAGGGTGCTAAAGTGGGTCAGAGCACGGCGAATCAAAAACGCTTGACGGCGGAACGTTGCGGGGAACTATTCGCTG
            TCGCCTTGGCCAACAAGATGGATCTCACCTGGTGTGGCCTCTTTCCAGTTAATGTTCTGGCCTATTGCGCCCGGAATGCT
            ACGCTGACCAAGATCGTGGGTCTATTTATGACCGAAAAGACGCTGAACAAGATCCGTGAGGGCAAGCTCTGAGATTTCAT
            AACCCCCATGTCGCCCCATTCCTGACCTCTCTCCTCCATAGGTTCTCCAGTCAAGATTTTTATACAATTGTACAACGTTG
            AGCTATACAAATATATACTGTATACACAAA
            
            Other Products of this Gene
            Other Transcripts
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0117199
            321
            Derived from OTHER transcripts
            Comments
            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            • Dana_gnomon_100_rna.6285225
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Secondary FlyBase IDs
              References (2)