Open Close
General Information
Symbol
Dana\GF22987-RA
Species
D. ananassae
Annotation Symbol
GF22987-RA
FlyBase ID
FBtr0127687
Feature type
Associated gene
Evidence Rank
Length (nt)
9284
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            TATCGGGTCATAAGCGGTCACACTGCTGCACAACCCAAAAGAAATAACTAAAATATAATTAATTAACGAAATATTGCACT
            AAAAGCGAACTTAATCCAGCCGTGGCAGCCTCACCCCGCCGCCCCCGCCACGCAGTACACAACACGCCCCCCGGCGGCCA
            GGCAGTTACTCGGCCAAATTCAGACGCCATTTCGCAAATTTTTTTTGCGAAAATTTTGTTCTGGGCAGGAAAAACTTTGC
            GAAATAATAGTTGCCGACGAGTTTGGGGTTCGCAACTATGAAACTGTGAGTCTGCAGCTTAAAAGTAAGCCCAAATCGAA
            AATTTCGAGCAACGGGACAGATAAAGTGAAAATTTTTGTTTATAGATTTTTGCAACTGTGCCCGCTGAGCAAGAATATGT
            AAACTTAAAGGAGCCAGTTCTTATTGGAAAAAGGACAATAAGATCGAGAGAGTGAGACGGACAGTCAGGGTGACAGGGAG
            CGCCAGGAGTCGCCGACCAACAGTGCCTCAAACCAGCAACAACAACAACAACAAAACGACGAACAGACAACTGGCAACTC
            CCCGCATCTCGCAACTTGGACACCGGACACTTCACAACTGCCATAATCCAGGAACAACCCAAAGCCAAAACAAAAATATA
            TACATTTATTGTTAAAAAAAAACAAGAAAATACCGCCCAGTGTAGACTGCAGTAGGATTACTAAGACACATAGAAGTAGG
            GCTCCTACTACAACTTCGCCGCCTCCAAGTCCGTCTCCATATCTCCTCTGGATTAAACCAATTTTGCTTCCGCTGCTGTG
            CAGGATCACGACAACGAGGAAGCTGCGTTAGCTTGGGAGGAGCACCTATTGTCACAATGACGTTCGACACGCGCAGGCAA
            GCCGGCGGCCAGCCGGGCAGCACATCGACCAGCAGCAGCAGCACGACAGCGACTACCACCACGACCAGTCCGGCGCAGAG
            CATGGGATCAGTCACGGGGACAGGCACTGGCACTGGCAGTGGCAGTGGCAGTGGCGCTGGCACAGTCACCACCACATCGA
            TCATCGGAGGTGGCGTTGGCGGGGGCCAAGTGACGAGCAACACCCAGGAGCAACAGACGCCATCGGTGGGCAACAGAAGT
            GCCGAAGTCACCGACGTGGTGGCCTCGTCTTCGGCGAGTAGCGTAGACAGCACCGTGACACTAGTGCCTCCAGAGAAGCT
            GATATCCTCGTTTCCCACGACCAAGCTACGCATGCTGACCCAGAAGATTTCCAATCCGCGCTGGGTGGTGCCTGTGCTGC
            CGGAGCAGGAGCTGGAAGTGCTGTTGAACGCGGCCATTGAACTGACTCAGGCTGGTGTCGACCACAACTGCGAGCCGTGC
            GTGGAGTTCTACCGCAACGGGCTGACAACATCTTTCGCCAAAATCCTCACCGACGAGGCGGTGAACTCGTGGAAGTACAA
            CATCCATCATTGCATCCTGGTGTCCTGCGGCAAGCTACTTCACTTGATAGCCATTCACATGCAACGCGATAATCCCTACC
            TGCTGGATCTTCTGGCGATAGTCTTCGATCCGGAGAACAAGTTCAACACCTTCAATGCAGCCCGCCATCCGGTGTGCTTC
            GCCACTCCAGACGCTATCTGGGGCCCGCTGGACAGCAACAAAATGTTCGCCAAACCGCCGCCAGAACCGAAGAATGCGCG
            TGGGTGGCTGGTAGATCTCATTAATCGTTTCGGCCAACTCGGCGGCTTCGACAATCTTCTGGAACGGTTCAACAGTGGGC
            TGGAGCTGCTGAAGCGAAATCAGAACAAGCCCACTGCCAAGGAAGCTAGCGATGGCCAGGACAACCGTCTAACGCTCGCC
            CTCATCCACAGTCTGCTGCGGCCATTTGGCCAGTGCTATGAGCTGCTGACTCCCGCCACCATCGCCAAGTACTTCATGCC
            GACCTGGAATGTTGTGCTGGACCTGCTGGACAGCTTCACAGACGAGGAATTGAAGCGCGAAGTGAAGCCTGAGGGCCGGA
            ACGACTACATTAATGGAATCGTGAAATCGGCACGCTTTCTGGCCAGCCGCTTGACCGGCCAGGAAGAGCTGATCCGCGAT
            CTGGAGATGTTTCGGCTGAAGATGATCCTGCGGCTACTTCAGGTGTCTAGCTTTAATGGCAAAATGAACGCTCTCAACGA
            GATTAACAAGGTGCTCTCCTCTGTGGCCTACTACTCGCACCGCTCGCAGCCGCTCCCCCATTGCATGCCGGAGGACGAGA
            TGGACTGGCTGACGGCTGAGCGAATGGCGCAGTGGATAAAGTCCTCGGACGTGCTGGGCATTGTGCTTAAGGACTCGTTG
            CACCAGCCCCAATACGTGGAAAAGCTGGAGAAGATCATCCGCTTCCTTATCAAGGAGCAGGCTCTTACGCTCGACGATCT
            GGACGCGGTGTGGCGAGCCCAGGCGGGAAAACACGAAGCGATTGTGAAGAACGTCCACGATCTGCTGGCGAAGCTGGCTT
            GGGATTTTACCCCCGAGCAGCTGGACCATCTCTTCGAAGCGTTCCAGGCCAGCATGACCACCGCCAACAAGAGGCAAAGG
            GAGCGGCTCCTGGAACTGATTCGACGACTGGCCGAGGACGACAAGAACGGAGTGATGGCCCAGAAGGTGCTGAAACTCTT
            CTGGACCTTGGCCCATAGTCAGGAGGTGCCGCCGGAGGTGCTGGATCAAGCGCTGGGCGCCCACGTCAAGATTTTGGACT
            ACAGCTGTTCGCAGGAGCGAGACGCCCAGAAGACCATCTGGCTGGATAAGTGCGTGGGCGAGCTGAAATCTGGAGACAGC
            TGGGTGCTGCCGGCCTTGCGTCTTATCCGGGACATTTGCTGCCTGTACGACACCACTCCGAATCATGCTCCGCGCACGCA
            GACGGGAACGAATCGGCAGCAAGTGATCGAGCGTTTGCAAAACGATTACACACTGGTTATTCTCGTGACGAACAGTCTGA
            CAGCGTACATGGAAAAGGTGCGTCAAATGGTGGCCGAGACGCCCGGACTGGATCCAGCTACCATTTTGATCGATCAGCGA
            TTTCCGCACCATGCCCAGATCGCCGAGAGACTGGAGTTCCTCAAGTTTCTCCTAAAGGACGGGCAGTTGTGGCTGTGCGC
            CGATCAAGCCAAACAGATCTGGCACTGCCTGGCGGTGAGTGCCGTCTTTCCGGCGGATCGTGAGGAGTGCTTCCGCTGGT
            TCGGCAAGCTGATGGGCGAGGAACCCGACCTGGATCCCGGCATCAACAAGGACTTCTTCGAGAACAACATCCTTCAGCTG
            GATCCGCACCTGCTCACCGAGAGCGGAATCAAGTGCTTTGAGCGCTTCTTCAAGGCGGTGAACTCCAAGGAGGACAAGCT
            GAAAGCGATACACAGAGGTTATATTCTGGACAACGAAGATCTCATTGGCAAGGACTACCTGTGGCGGGTGATTACGACGG
            GAGGCGAGGACATAGCCGGTAAGGCGATCGATCTGTTGAAGGAGGTGTCGACGGCGTTGAGTCCCAGGCTGCAAGAGAAC
            GTTGCCGAGTTCCATGAGATGTTCATCGGCGAGTGTTGTTCCCGCCTGCGCAACCATTATGGAAATATAATGATCCTGGG
            CAAGACTCAGCTGCAGGACGAGCTCGAGGCGCCCGATCAGTCGGACAACGCCAATGACGAGTCGAAGGACGCCAAGATGC
            GCTTCATCGAGGCGGAGAAGATGTGTCGCATACTCAAGGTGCTGCAGGAGTACGTGAAGGAGTGCGACCGCTCCTATAGT
            GGCGACCGCGTCCACCTGCCCCTCAGTCGGGTTACGCGGGGCAAGAACACTATTCTGTACATACGCTTCCAGACTCCGGG
            GCGGCCCATCGACGACCTGGAGATTGTGACGCACAGCAACGAAACGATGGCCGCGTTCAAGAGGAGCCTCCTCAAACGGA
            TCAAGGGCACCTCCACGGCCAACATCAAGGTTGATCTCTTCTACACGAACGGCGAGATGATCGAGGTCTCTGACGAGATT
            AATCCGTTGTACCAGTACACTATCCGGGACAAGATGGTTCTCACGGCCAAGCTAACGCCAGTGGGCACCGGCTTGGCCAG
            CAGCCCCGACTCCTCGAGTGACTCCAGCACCGGTTCACCGCCTCGCCCCTGCCCCGACATGCAGCGCATTGAGTCTGAGA
            GCACCTTGCCCGGGGTAATCATATCGCAGAACTACCAGTACACCGAGTTCTTCCTGAAGCTCTATCAGCTGGGCAGCGAC
            CTGGAGCACGGCCGTCTGAGGGACAGCGCCAAAGTGCTGCTCCACTTGCTGCCCTGCGATCGCCAGACGACGCGACAGCT
            TCAGCTCATGTGCCGGGTGCCCAAGGCGGCCATTGCTGCTGTGGCTGTGGGAGAGAAGGCTGCCAAGGAGGACGAGGAGA
            AGCAGAATTCAAGTGACCAGTCATCGAGCGATCCCGAGGAGGAACACTGCACGCCGGAACAGATGTTCCTCCACCCGACA
            CCAGCCCAGGTTCTGTACAACTTGAGCGTTCTGCACGGGCTGCTGATTCCTGCCCTGGACCCTCTGGGCGAGGCAGCCCT
            GCAGGTTCAATCCGCTTGGATGCACTCGGGCTGCGCCCACTTTGTACTGGAACTGCTGACAAAGAATAATTTCCTGCCCA
            GCGCTGACATGCACACGAAACGGGCGTCGTTCCAGTGTGTGCTGCGCTTGGCGAAGCTGTTCCTGTACATCGTGGGCAGT
            GTGTTGTCCCGTGTTGGGGACGAGCCCATGATCTGCGACCTGGACAATGGAGCCCGTTCCCAAGTGGACATCCTGAAGCA
            GAACTTCTCGACGATGCCAAACAGCTCGCAAGGCACCTTGCGGGCCATCTCCGCCAAGTTGGCGGTGATGCTGGCACGCG
            AGATGCTGTCGGCCACTCCGGAGGGTGAGCGCTGCCGCACACTGTTCAGCTCCACATTGCAGTGGTCGTGTCCGGACATC
            TCCACCATCAAGGCGGTGGTGCAGCTGGCGTGGGCCTCGTCCTGCGGGAATCTCCAGGCCCTGGGCAGCAGCAGCAACGC
            TGGCGGAGACTTTGAGGACGAGGTGATCGTGCCCGATGGCCAGGACTTTAGCATGTGCAAAGAGGCGTTGGAAGTGCTAA
            CCATTTCGTTCATACTAAATCCGAGTGCCAACGAGGCCCTAAGCAGCGACGCCAACTGGCCGAAGTTCATCACATCGATC
            GTGCTCAAGAATCCGTTGCGGCATGTGCGGCAGGTGGCCTCGGAGCAGCTGTTTCTGGCCTCCACCTACTGTGCCGGCGA
            CCGGCGGCCATTCGTCTACATGGTCAACTTGTTGGTGGGAGCTCTGAAAACCCTGGTTCCCCAATACGAGGCCACTTGTG
            CAGAGTTCTTCTCCATGCTCTGTCGCACACTGTCCTATGGTTGCATCTACAACTGGCCGCTGCAGATCGGCGAGGGACTT
            TTGGGCGATGAGATCAAGTGGCTGCAACGCATCCGGGAGAACGTTCGGGCTACCGGTGACACCCAGGTGCACGAGGAGCT
            GCTGGAGGGGCATTTGTGCCTGGCCAAGGAGCTTATGTTCTTCCTCGTCCCGGACTCGAAGGCACAGCTCAATGAGCTCA
            TCCACGAGCTCATCGATGACTTCCTGTTTACGGCCTCGCGCGAATTCCTGCATTTACGGCGGCACGGCAGCCTTCGGCAG
            GACACAGTGCCGCCTCCCGTTTGCCGCAGTCCGCACACGATTGCCGCCGCCTGCGACCTTCTAATTGCCTTGTGCCAGCT
            CTGTGTTCCTAATATGAAGCTACTCACCAATACACTAATCGACTTTGTTTGCACGGACACGGATCCGTTGCGCGAGTGGG
            ATTATCTGCCGCCGGTTGGCGCCAGGCCCACAAAGGGTTTCTGCGGACTTAAAAATGCCGGGGCCACCTGCTACATGAAT
            TCGGTTCTGCAGCAGCTATATATGGTGCCGGCGGTGCGGGTGGGCATTCTGCGGGCCCACGGTGCTGCCACCAACGATGG
            CGAGGACTTCAGCGGCGATTCTGATTTGACGGGCGGCGGTCTGGGACCAGCTCTCTTCTCGGGTCCCTCCGCTGCCCTAG
            TCTCCTTCTCCTCGTCGTCGTCGTCATCGTCGGGCGCTGGCGAGGATGGGGCCCAGGATGTCCGGAAAAACTACCACGTG
            GTTATTCTGAAGCACGTTCAGGCCATATTTGCCCACCTGGGTCACAGCGCTCTGCAGTTCTATGTGCCCCGCGGACTATG
            GACGCATTTCAAACTGCAAGGAGAACCTGTGAATCTGCGGGAGCAGCAGGATGCTGTGGAGTTCTTCATGTCCCTGTTCG
            AGAGCCTCGACGAGGGACTGAAGGCACTCGGCCATCCGCAGCTGATGAACGCCACGCTGGGCGGCTCTTTCAGTGACCAG
            AAGATCTGCCAAGAGTGCCCCCATCGCTACTCCAAAGAGGAACCATTTAGTGTATTTAGTGTCGATATTAGGAATCATAG
            CTCATTAACCGAATCTCTAGAGCAGTACGTCAAAGGGGAGCTGCTCGAGGGAGCGGATGCATACCATTGTGATAAATGTG
            ATAAAAAAGTAGTTACCGTTAAGCGGCTATGCGTGAAGAAGCTGCCACCCGTGTTAGCCATACAACTGAAGCGCTTCGAA
            TACGACTACGAGCGCGTCTGTGCGATTAAATTTAATGATTATTTTGAATTTCCGCGTATTCTGGATATGGAGCCCTACAC
            AGTGTCTGGCCTAGCTAAGCTAGAGGGCGAAGTGGTGGAGGTGGGTGATAATTGTCAAACAAACGTTGAAACAACAAAGT
            ACGAACTGACCGGCATTGTGGTGCACAGTGGACAGGCCTCCGGGGGCCACTACTTCAGCTACATACTATCCAAAAACCCA
            GCGAATGGTAAGTGCCAGTGGTACAAGTTTGACGATGGCGAGGTAACCGAGTGCAAAATGCACGAGGACGAGGAAATGAA
            GGCACAGTGCTTCGGTGGCGACTACATGGGCGAAATTTACGATAACAATCTGAAACGGATGCAGTACCGCCGCCAGAAGC
            GTTGGTGGAACGCCTACATGCTGTTCTATACGCGCTGCGACCAGAATCCCGTACAGTTCGAGCCAAGTGTGGAGCAACTG
            TCGCTAACGGAAAGCCGAAACATGGTCCTGCCCCTGCCTAAGCCCATCGAGCGTAGCGTACGCCATCAAAATATAAGGTT
            TCTGCATTCACGTAGCATCTTCTCCGTGGAGTTCTTCAACTTCATAAAGAAGCTGGTCAGCTGCAATATCCCATCTGTCC
            GGAGCGATAAGATCACACCCGCCGCCGAGGAGCTTTCCCTGTTGGGCGTACAATTGGCATCACAGTTCCTGTTCCACACT
            GGTTTCCGTACGAAGAAATCACTGCGCGGTCCCGTCATTGATTGGTACGATACGCTTTCCCATCATATACGCTCCTCGGC
            ACTGGTGCGGAAGTGGTTTGCCAACCACGCCCTGCTGTCGCCTCCCTCTCGCCTGGGTGAATACATCCTAATGGCGCCCT
            CGCCGGAAGTGCGCACGGTGTTCGTGAAGCTGGTAGTGTTCTTCTGTCACTTCGCCATCCACGATGAGCCATTGCCCGGG
            TTCGATGGCGCCAATCTCTGCGAGCAAGTGCTCATCAGTGTGCTGCGTCTGTTGAAGTCAGAGGCAGCCGACTACGGTAA
            ACATCTGCCGCACTACTTCAGCCTTTTCAGCATGTATGTGGGGCTCGGAACTCGCGAGAAGCAGCAGCTGTTAAAACTAA
            ACGTCCCGCTGCAGTTCATTCAAGTAGCCCTCGACGATGGCCCAGGTCCGGCCATCAAGTACCAGTACCCGGAGTTCAGC
            AAACTCCACCAAGTGGTTTCCCACTTGGTGCGTTGCAGTGATGTGAGCGAGAAGTGTCAGAGCTCGAACCAGAACGCCCG
            ACCCCTTCCCAATCCGTTCAAGGATGCAACGGTATCGCAAGAGGAGCTCACACCCCTGTCCACCGAGTGCATGGACCTCC
            TGTTCAACCGCACTGGCTACATCAAGAAGGTCATTGAGGACACAAACGTGGGCGACGAAGGCCTGAAGCTGCTGCAGTAT
            TGCAGCTGGGAGAACCCTCACTTCTCACGGGCTGTACTCACAGAGTTGTTGTGGCAGTGCGGCTTTGCCTACTGCCACGA
            CATGCGCCACCACACGGACCTGCTGCTGAACATCCTGCTTATTGAGGACTCGTGGCAGCACCACCGCATCCACAATGCGC
            TGAATGGAGTGGCCGAGGAGCGCGAGGGACTGTTGGACACAATTCAGCGGGCCAAAACGCACTATCAGAAACGGGCATAC
            CAGATAATCAAATGCCTGACGCAGCTGTTCCACAAGTCCGAGATTGCTCTGCAGATGCTCAACACCAACGCCACCATCAG
            CCGGCACTGGAGCGTTGCCGTCGAGTGGCTGCAGGACGAGCTGGAGCGGCAGCGGGGCATCGGCTGTCAGTACAACTCCT
            ACTCTTGGTCGCCGCCGGCTCAAAGCAACGACAACACCAATGGGTACATGCTGGAGCGGTCGCAGTCGGCTAGAAACACA
            TGGACCATGGCCTATGAGCTCTGTCCAGATGAGATAACCGAGAAACCGGATCAGGACGAGAACAACGAGTCTGATTTGGA
            GTCCAATCTAGACGAAAACAAAGCGGACCCGGCAGCACAGACTGCAGAAACGCAGGAAGGCTTAACTGGAGGCACGGAAT
            TGGTGGGCGATGCCAAGCCTGCCACCACCAGTAGTCCCTCAACTGGCGCCTGGCTGGCTCGAGGGGATAATAATGCCATC
            CCACGGCTCTCGCGACAGCTCTTTGGAGTGTATACAGCAACAACACCCGCAACGACAACGACGCCAGCAGCAACGGCGGG
            CAGTGGGGCAAATAGCGAGACTGAGAGCAGCGCTCAGGAGACGACAACCGGAGAGACGACGTTAAATGGGCTGACCAATC
            GATTGGACCATATGGAAATCAAGGCCAAAAAGGGCGTGCGAAGTCGGTCAAAGGGAGGCAAACTGCCGCCAGTACTCTTT
            CACCAGCACCAGCTGCCGCCGGAGCAGCAACTCAAGCTGAAGCAACAACAACTGCAGGCTCACCAGCATCAGCTCAGCCT
            GCAACTGCAGCCCAAGCAGCCGCACGAACAACAGCAGCAACAACGTGGTGATACTAGCAAGAGTTCCTCAAGCCGCTTGA
            TTTGATTTGCCGCCAAATATATCCCAAAAACTTCAGTATGACGGCAAAAAAGCTAGAAAGTAAGGAGAGGAGTGCTGAGG
            AGGC
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0388056
            10306
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0126179
            2782
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0347795
            2781
            Comments
            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            GNOMON
            • Dana_gnomon_100_rna.8346197
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Secondary FlyBase IDs
              References (2)