Transcript Dere\GG12582-RA

General Information
Symbol	Dere\GG12582-RA	Species	D. erecta
Annotation Symbol	GG12582-RA	FlyBase ID	FBtr0132636
Feature type	mRNA	Associated gene	Dere\GG12582

Evidence Rank		Length (nt)	312
Evidence Score

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
Sequence
	ATGACTGGTCGTGGTAAAGGAGGCAAGGGCTTGGGAAAAGGTGGCGCCAA GCGACATCGCAAAGTGCTGCGTGATAACATCCAAGGAATCACGAAGCCTG CTATCCGCCGTTTGGCTCGTCGTGGCGGTGTGAAGCGCATATCTGGACTT ATATACGAGGAAACGCGTGGCGTTCTGAAGGTTTTCTTGGAGAACGTAAT TCGTGATGCCGTCACCTACACCGAACACGCCAAGCGGAAGACTGTTACTG CCATGGATGTTGTGTACGCTCTGAAGAGGCAAGGCCGCACCCTCTACGGA TTTGGCGGTTAA
Other Products of this Gene
Polypeptides
Derived from THIS transcript	Name FlyBase ID Length (aa) Dere\GG12582-PA FBpp0131128 103
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • XM_001982918
Synonyms
	Dere\GG12582-RA GG12582-RA
References ( 1 )
Research paper	Drosophila 12 Genomes Consortium et al., 2007, Nature 450(7167): 203--218 Evolution of genes and genomes on the Drosophila phylogeny. [FBrf0200326]