Open Close
General Information
Symbol
Dsim\GD18345-RA
Species
D. simulans
Annotation Symbol
GD18345-RA
FlyBase ID
FBtr0218255
Feature type
Associated gene
Evidence Rank
Length (nt)
646
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            CACGTGCTAACCAACACTAATCTGTTGCTTCGCATTAAAAATTTTTGCTTGACTTGACAGGTTCGTAGAAAAGTCCCAGA
            AAAAAACGCAGTTCCGTCGGAATTAAGGCAGCAACTATGTCGTATCAACTGTACCGCAACACCACGCTCGGCAACACCCT
            GCAGGAGAGCCTCGACGAGCTGATTCAGTACGGCCAGATCACGCCCGGACTGGCTTTCAAGGTTCTGCTGCAATTCGACA
            AGAGCATCAACAATGCCCTAAACCAGCGGGTCAAGGCCCGCGTCACCTTCAAGGCTGGAAAACTAAACACCTACCGCTTC
            TGCGACAATGTCTGGACTCTCATGCTCAACGATGTGGAGTTCCGCGAAGTGCACGAGTTCGTCAAGGTGGACAAGGTCAA
            GATCGTGGCCTGCGACGGCAAGAGCGGCGAGTTCTGAACACCACTGACCCGATCTTAACCCATGTAACCCCACTAAACAC
            ACCATTTCACCCAAAAAAAATACACCATGTAACCCCACAAAACACACAATTATAACCACTACAAATAGCTGTAAGATTCG
            TAGGCGATAAGCTGGGTTGGCCAACAAAAACCGACCGTGCGATGCAGCAGGCATTGCAACAAATACACTGTTAATTCACA
            GTTCAA
            
            Other Products of this Gene
            Other Transcripts
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0216747
            106
            Derived from OTHER transcripts
            Comments
            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            • Dsim_gnomon_101_rna.20193122
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Secondary FlyBase IDs
              References (2)