Open Close
General Information
Symbol
Dmel\Fis1-RF
Species
D. melanogaster
Annotation Symbol
CG17510-RF
FlyBase ID
FBtr0273211
Feature type
Associated gene
Evidence Rank
Length (nt)
704
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATTTTTAGAATGAACGGCTACTCTTGGCGTTAAATTCTCTGTATATAATTTTTGTATTTGCTAACAACATTTGCCAAACA
          ATGGAGGATCTTTTAAACGAAGTTGTACCACAAGAAGATTTAGAAGTAAAAAATATTATTTTAGTTCTGATTGTTATAAA
          ATAAATATTTTGCATTTGCTCCAGAGATTCGAAAAAAAGTATCATCACGAACTTGAGTTGGATGGTGAAGTTACCACAGA
          CACAAAGTTTGAGTACGCATTCCTAAATCTAAAAACATTAAAATATCTCAATTCTTCTCAATTCTAATGACACAATAGGG
          AATTATGATTTTGGAGGAACTGGCTCGTACGCATCCAGATGGAAGGCGTGACTATATATATTATCTTGCGTTTGGTAATG
          CTCGTATCAAGGAGTATACGTCTGGCTTAAAATACTGCCGAGCTTTTCTTGACATCGAGTCAAATGATCAAGTTCGCTCC
          CTAGAGGAATATATTAAAAAAGAAATCGATAAGGAAGTGGCAAAGGGTATGGTGGTTGCAGGCGGAGCAGCTTTAGTACT
          TGGCGGAATATTAGGACTTGGCATTGCTATGGCTAGAAAGTAATATTTTATACCAACACGTTTTTAACCGACAATGTTCT
          TTTAAAAACAAGCAGTTGAAAATTAAATATTTATGATTTAAATTAAATCTACATTGACTTAATT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0086073
          630
          FBtr0273208
          698
          FBtr0273209
          560
          FBtr0273210
          628
          FBtr0345012
          557
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0271719
          92
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0085409
          98
          FBpp0271716
          154
          FBpp0271717
          92
          FBpp0271718
          148
          FBpp0311263
          98
          Comments

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          3' UTR based on RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG17510-RF
          Fis1-RF
          Secondary FlyBase IDs
            References (0)