Open Close
General Information
Symbol
Dmel\CG13305-RC
Species
D. melanogaster
Annotation Symbol
CG13305-RC
FlyBase ID
FBtr0273349
Feature type
Associated gene
Evidence Rank
Length (nt)
1138
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGCAGTTTGATTCTAGGTCTCATCCCCGTCAGTCTAGCTGATTTTCCTCTTTTTTTTGGTTTTTTCTATTTTACAATTT
        TCTCGCATTTTATTTGCCATATCTTATATAAGCCCTGCAGCTGACCGTTGGAGCATTGCACAATCCGGGGCAGCAGCGTC
        GATCGATTTCACACACCGCTGACTGCTGGGCAAGTGACTTCCGGCTTTTGGCCAAGCCCCGAAAAGTGGCCAACTATAAA
        TGGCTATGTTGTTGTCAAAATGCTGCCACAAATTTGACGAGAGTGCAACGCGATGGATCTGCCAATTGGAAAGTTAAACG
        GACTGCTAAAGATGCAAATATTCCTCCTGCAATTGTTGCTTTTCGTTTCGCCGGCATTGTTGCAGCAGCCACATGTCTTT
        TACCATCCAAGACAATTGTATTACGATTCACCGCGTCTTCGTCGCTTTGAGTATGGTGCCGCTGCCACGCCCATTGTGGG
        CGGCTATAGTCCGGCTCCTCCGCCGGCGATTCACTTTCAGCAGCAGACGCCACACTTTCAGCTGATTAACTATCGGCCGA
        GTTATCAGCCCTTGGGCTTGGATTACCAGCAGCAGCAGTTGCCCGCTCCTGCCGCACCCCCTCCGCCCCTGTATCCGCAG
        CAGAGTGTCCAGTACCAGCAGCGGACCATCGCTCCACACGCCGATTTGGCCAAATATCGATATGAAGATTGCAGGAGCAG
        CAGCAGCAGCAACCCTCACAGAATGTCCAAACGGAAAGACCCAGGAGGTACGCCAAGGATCTGGACACGGATGTGGCCGA
        AACCAGAAGTCCAGCTGACCGAAGTGCCAAGGAAACCAAGTACTTTCATGACATTTTCATGCGCTTTGATGCACCCGATT
        CGCGGAGTCATGGCCACGTCCTGAAGCATCCGAAGGCCCAGGAAAAGCGATTTGAATCCCAGCGAGGCACGAATCGTTAC
        AAGGGCGAGGTGATTTGGACAGATCGTCAAGGAGGTCACGGCGAACATCGTTGGGACATGGCGCAGGGAAAACTCTGAGA
        TCAGACCTCGATTTGCATACTCCATAACATTTTTCCCATCCCCCCCAAAAACTCTCTGTACATACCCATGCGAACTCGCA
        TAAATCGTGACTTTTCAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0273348
        1364
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0271857
        203
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0271856
        323
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        The first intron, which throws off the reading frame, is supported by cDNA but not by RNA-seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG13305-RC
        Secondary FlyBase IDs
          References (0)