Open Close
General Information
Symbol
Dmel\CG7546-RC
Species
D. melanogaster
Annotation Symbol
CG7546-RC
FlyBase ID
FBtr0290025
Feature type
Associated gene
Evidence Rank
Length (nt)
4841
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 71 )
Sequence
GGCTGCTCTTTCACTCCGAGAGTTGGCAACACTGCCACACTGTCAAATTCCAGTAATTATTCTCGTCCACTGCTGTTGTT
GAATTGCAAAGTCGCTCGGCGCGTTAGCATAGAAGCCCAGCATATATTTGCCCGATCCGAAAGCAGGCGGAGATCAGTGA
AAACGTATACATATTTACCGCTAGTTGAGCAGTGCGAAAACGTGTCCGGAAAAGCCAAAGGCCAACGACAGCGAGTGCGA
GCGAGAGAGCAGGTGACAGCGACACCGACAAGATTCCCCGCCTTCCCCCCTCCACCAACGAACCCTTTTCGACTGTTTTT
TTGCACGGCACGGGGAAAACCGAAAGAAAAACGAGATTTTCAATTGATTTGCGACGCAGTCCGGCCGGAAAATGCTCATA
AACCTTAAGGTGAAGACCTTAGATGCGCGCATCCACGAATTCAGCATCGACAATGAGCTCACCATCCGCCAGTTCAAGGA
CCAAATAGCCGAGAAGACTAACATTGCGGCGGAAAACCAGCGTATCATCTACCAGGGTCGCGTTCTGGTCGATGATAAGC
AGGTGAAGGAATATGATGTGGATGGCAAGGTGCTCCATGTGGCCGAACGACCACCATTCTCGCAGCGCGGAGCCAATGCC
CGCAACAATGATGAACCCATGCGAACCTTCCGCAATGTGGCACGTCCGCCGCCGCCCGGAATGCGTACTTCTCCGTACTT
CCGCGCCCTCGATGGAATGCTGGTGGGCACCATGGCCATACCGGTGAACAATGGTCCAGTAGCTGGGACACGTCCTCCAC
CGAATCGTTATCCCAACTCGTCGTCCTTCTGCATTAACCGCATCACGGTCGCCCTGCACATGATCGATTGCGCTGACAAT
ATAGCAGCTTATCTGGAAAATCCTGCCGTTGGCCTGAACAATCAATCACTGGACATTCTGCAGCGCGGTCGCTGGTCGAT
GGAGTCCACAGTCGTGGAAGTAGGTGTCTCCTCGACTGATCTGCCACGCAACAATAACATCATCGATATGGTCCAAGATG
CCGTGACCGCTGCTCTTTCGCATACAGGAGCACGCAACTATACGGTGGTTCAGCTGCCCACGGTTTATACCAATGAGAAT
GGCGAGACGAGCCAGCAGAGAACAGCCGAAGCTATAACAAGTGAGGGAGCAGCCAGTGGAGCTGCAAGTAATGCTAGTGG
TGAAACCACAGCTGCTACTGTGATTATCGAGGATGTTATCGAAACGGACGACGAAGTGGCCGATGGAGCATCAGATCGTT
CGGTCACGCCAACACCAGAGCCGGAGGCGGAAGGAGCAGTTGGTGGCCAGCAAGTCACTGCAGCAGAGACTCCCACATCC
TCGGTTGGATCAGCAAATGACGCGGCTGCCGAAGGCGGCAACAACTCAGGACCCAGGCGACGCACTCGTCCTCAGGTGTT
GGCCCAAGTTATTCAGCACTATCGTGGCGTACAGGCTCGCTTGGCGCCTTTTGTTGATCGGTACTATGAGATTCTCCAGA
ATGATCCCACTTTTGAGGAGAGTGACACCGATGGTCGCGAGAACGCACAGCGCATCTTCGATCGCGTCTCGGAGGCTTTC
CACTACCTTTCGCACGCCCAGCACGCTATATCCGATTTAATGCTTGACCTGTCGCAGCCAGGGCCACGTGTGCTCACCTG
CCGACCCATTCTCGTTGAGCAGAGCGGTTACATACGCTCCAATAACATCTTCACGCCCAACTTTTTGGCACCGCCCTCGG
GTATTATCAACGAGCCTTTCCGCAATAGAGCACCTGGTTCTGCCTCTGCAGCTGGCACTCAAACGGCCACCACAGCGGGC
ACTCAAACGCCCACCAGCGCGGGCACTCCAACTGCTGTGGCACCTTCGCAGGCTGCCAATTTGCAGGCGGCCACCGATGC
CAGTCGCAGTGCAGCGGCCATGGCGGAGATCGCCAGTCGAGCTGCTGGAGCCGCTGCGGAAATGGCTGCCGGAGCTGCCA
GTGCGGCTGCTGGAGCTGCGAATGCGGCTGCCGCCGCCGCTCGCGATTTATCCAGTGATCAAGTAGAGGATCCCATCGAC
GAGCCTATGGTGGGGCCAAATGCTGCAGGTGCTGAAACACTAGCACAAGAGCAACAGCGTCTCGAAATGGATCACGACCA
CGATCAAGCTCAAAGTGAAACTCCCGAACGAGAAACCCGACCAGTGCCTAGGCTGCGTGTCTATGTGCCAGTGACTTTGC
CACCGCCCAATCCCCAATTGGAAATGGCCCGAATTATTCAGGCAATGGTCAATGGTCAACGACCGAACGATATCCATGTG
GAATTCAATGCCCCCAACGTCATGTCGATTAACTTGCCCGTGCATGTGATGACGACCGTGCGACAGGCTCCGGCAGCTGG
ATCGAACGAAACAGCAGATCAGTCTGCGTCCGAATCCTCCTCCCCTGAAAGTGCGCCTGCGTCGGGCAATGGAGAGTCTC
CAAATGCAGCTTCAACATCAAGTGGAACACGCAGTGGCGATCAGAGGGCCAATACCTTGCCCACCACGGCCACCCAAACG
CGCTCGACATCAAGACCACAGATTCAGATTGGCGGAAACAACAACTGGGGCGGACGCATTGCTCCGACACACACGGCATT
CGACCGCTTTCTGCCTTGCAATAGTCATCACATTCGGGAACCAGAGCAGCTGCTCCAAAACAACAGTACCAGTCGCAGCA
CCTCGACAGCACCAGCAGGAGGAGCCACCGTTGTTCCGCCCACATCTGCTGCAGTAACTCGTCCTGCTTCGGTAGGCAGT
GCAGTTGCCGCCGTCGGAGATACGGCCGCCTCACCATCAGGAGAAGCTGCCCCAATTGCTTCAACCACGCCAGCTGCTCC
GCTACAAACTGTTTTGCCGACATCCACACCCACTCCTCGCGGAGACTCGAACAACCTGCGTTCGCAACTGCGCACCTTCC
TCAACGACAGCCTGTTTGTCGGAGTACCCATCAACGAGCAGACTATTCCGGGGGCCATTGGTCGCGCACTAGACTGGTTC
GGGGAGAGCCTGGTCTACCTGCCGCAGTACGAGCGTCCGGAGTACAACTCGCGCGACTCTGTGTGCAACATCCTGCGTGT
CAGCCTCCGTTTGATCATCGAGCTTTGTAATGGAGCTCCGGCCGGTGTAGATAGTGCTCAATTCGAGCAAAGTCTCAAAC
AGATTTGTGACCAATTCCGCAAGCGGCTATACAGCGTTCTCTTCCTGTGCCTTGGAAGCGCGAATGCGGAGCTCTATTGG
CGCCAGCTAATGCGCCTCCTTTGCGCACCGATGCGATCCAACTTCCGCAACGAAGCCCTGCAGTTTTTGTGCATCTACAT
AGACCCCACGATTCCCGCCCAAACTGACACAGTGGATGCCCAACAGTTCCTGGTCTTGCGCAGCATTCAAGCAGCTCCTC
CAACAGCTGCCGACGAGCAGCAGCTGCAAGAGCAAACTCTGGACACGGATGTTGAGATGTCCGAAGTGACCGCCAGCGGC
AGCAACAGTTCACCGGCAGACGAGCTACCAGCTGTGATTGTGGGCTCAGAGCCTTGGCACATGAGTTTCCCCAATGATTG
GTTGCCTGTGATAACGCGCGACCTACAGACCCAGGCAGAGCAGAGTAATCGTCCCCAGCCGCCCTTCTCGGATGCCTACA
TCTCGGGCATGTCCGCCAAGCGCCGCAAGATAATTCAGTCGGAAAAGCCGACTGCCAGCGTGGAGTGTCTCATTGCTAAT
GGAGTGCAGAGGGCTATCCAGAGCGTCGGCTTGGGTGGAAGCAATGGTGGTAGCGCCTTAAACGCGTCGATCAGTATGGA
TACCGTAATCGGATCCATTGCTCACGACTCCACCATTCAGGCCGCCTACACGGATGCGGTGCGCAATAGTTTAAAAGAGC
GTACCGAGCGGGATGTGGATTTTAAGACCAGCAAGTATCCGCAGATTGCCAAGTTCACCGAGCAAAAGTAGGGGGCAGAT
ACGGAGACGGAAGCCTGGCCACCTAATGCTTCTTGTACATTTTACTTTAATAAATTGTATTTAATTTAGTTAATGGTTAA
GTTCTGTTTAAATCGAGAAGACGACGAAGATTGCGACAACACCAACACACGGAGTGGACCCTTAGCAAATGCTTCAAACT
ATTTAGAATAATAATATCCAACTGATATTTATCCACACACACACAGAGATACACACACACAATGGGTCAAGACGCAACAG
AGCCCAATCAAAAACAATTTTTGCGGTGCATGAATGAGCAAAATAAACACACATATTAACCGAAACAATGGCGATTGGAA
TTGGATTAAATGGACTTGGATATTAGACCACACACCGAGCGGAATGCTTTCAATTGTCCCAAATGGCGGTGGCGTCCCCG
CGTCGGATGACGTGCTGCAAAATCAGAACAGACCCGTAGACCCGTGACGACAGCCAAATTCCGAATTCCAGCCAAGTATT
TTGGCCGGCGCCAAATCGCCATTGACGTGAGCCGATGGCACATGATTGCTGGACGGCCGATGACGACCAATCCGGAATGT
GCAGATCTATTCAAGTGGATAAGCCTTCAGCAGAAGCATTACCGGAGGCATATCCACACCATCCCATCGTACCAGCAACC
CGCACCATCCCATTTCATCGTCATCGAAGTCCGAAGCCTACGCTACTCTTGTTATTGTTGTCGCCTGCAATCGAAACACG
AAAATGTGTCACATAAAAATGTTGAGAATATTTATGTGCAAAAAAAATAAAATAAAAACAAAAAGAAATACCAAGAAGCC
GTAAAGAAAAGAAAACATATGAATAAATAATAATTATAAAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0076791
5240
FBtr0076792
4742
FBtr0290026
5282
FBtr0305073
5138
FBtr0332141
4745
FBtr0332142
4781
FBtr0332143
5240
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0288464
1199
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0076505
1332
FBpp0076506
1166
FBpp0288465
1346
FBpp0293610
1298
FBpp0304451
1167
FBpp0304452
1179
FBpp0304453
1332
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG7546-RC
Secondary FlyBase IDs
    References (0)