Open Close
General Information
Symbol
Dmel\CG13896-RB
Species
D. melanogaster
Annotation Symbol
CG13896-RB
FlyBase ID
FBtr0290220
Feature type
Associated gene
Evidence Rank
Length (nt)
972
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GGATCATGATACCTTTCTCTTACGCCGTCCGAAAGAACTGGCAGCCTGGGAAACAAAACTTATTCGTCATCAACTGAATA
          GCTATTGTAAACAATGGATACAAACTTACGAAAGGAAGTGGTGTACATCCAACACCCGACTTTTATTGTCCCTTTACAAT
          GAACGCCAAGCTGATTTTCGGGATCCGAAAAAAAAGATCAAGGACATTTGGGGGGAAATGGTCGTTGCCCTTGAAAGCCA
          GGGAATGACAGATATCGATGCAGTTCAGCTGGATCGAAAATTTAGGAACCTGAAGAAGACCTACTATAGCATAAGGAGCA
          AGCTCCTGGCGAAGGTACCGCATTTCCATCCAAACTGGCAGTTCTACGACGAGATGTCCGAAATTCTAAAGGATGACCCT
          GTCCCACCGCCGCAGGAACTTTCCATCAATGATTTCGATGAAGCGGTGGTCAGTTTGGAGACCGGTATCCAGAAAGGCAG
          GATGCTGTCTATGGGCACCACTGTCAGCACAGTTATTCCCCGCCAAATGCGTACGTATCGCAAACGAAAGCAGCCATTGG
          ATGATGTCGATATCAAGATCCAGAAGGACTACGAAGTGCAAACGGATCGGCAGCGGGATGGGGAACAGTTTACAGTCTTT
          AATGCCGCCGAACCCAATACTAATGATTTGTCAGAGTCTGCGGCCGAGATCTCCATCAGCAACGACGAAGAGGCATTGAG
          ACACCTAAGAGCGCTCCAGGAGTACGCCATGATCCATGATAATTTCAGGGCCATAGGACTGCTAATACAGGTGGAGCACG
          CCATTCAATATCCAGCCCAGATCAAGGACTTCGAGGTGGATCAAACGTAGTGTCCTTATAAACAAGCACGTAATCTACTG
          GAAAAGCAAAGATAAGATAAGGCACATACCTAATTTATACCTCTATATTTAAGATTTTAATATTTTATAATATATATACT
          TTAATTTACTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0072602
          1000
          FBtr0331770
          974
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0288659
          210
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0072498
          210
          FBpp0304157
          210
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG13896-RB
          Secondary FlyBase IDs
            References (0)