Open Close
General Information
Symbol
Dmel\lqfR-RC
Species
D. melanogaster
Annotation Symbol
CG42250-RC
FlyBase ID
FBtr0299515
Feature type
Associated gene
Evidence Rank
Length (nt)
2707
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 93 )
Sequence
TTGGAAACACTGTTTGCAACACTGGACACGACAGCTCACCAAATATTAGCTGCTGTGATTTTGTTTTACAATTTTCGTTT
AAATTTTTACATTTTTGTTTGCGGAAAGCGCGGGTGCGAGACAGGTGCGCCGTTTCCATGCAAAAGTGCAAATCGTCAGC
TGCAAAACAGTCAGAAAACGGCACGCCAAGCGAAAACGAGTTCGACGTCTTGTTGTAGTTGGATTTTCCAGCCACTTTTC
GACGAGATTGTGTGAAAAATTCCGTAGCATTCAATAGTCTCAAAATGGTGGATAAATTCATCAGCATGTGGAAAGTGCGC
GAATTGGCGGACAAGGTCACCAATGTCGTGATGAATTACACGGAAACGGAGGGCAAGGTGCGGGAGGCCACCAACGATGA
TCCTTGGGGGCCTACAGGACCCCTCATGCAGGAATTGGCCTATTCCACCTTCTCATACGAAACATTCCCGGAGGTGATGT
CCATGCTGTGGAAGCGCATGCTGCAGGACAATAAAACCAACTGGCGACGCACGTACAAGAGCCTCCTTCTGCTAAACTAT
TTGGTGCGAAACGGCTCTGAACGGGTGGTAACCTCCTCTCGGGAGCACATCTACGATCTGCGCTCGCTGGAGAACTATAC
ATTCACCGACGAGGGCGGCAAGGATCAGGGTATTAATGTTAGGCATAAGGTACGAGAGCTTATAGACTTTATTCAGGATG
ATGATCGTTTGCGCGAGGAGCGCAAAAAGGCGAAGAAGAACAAGGACAAGTACATCGGCATGAGCAGCGACGCCATGGGC
ATGCGAAGCGGTGGCTACAGCGGCTATAGCGGTGGATCTGGAGGAGGCGGCGGTGGCAGCGGTGGCTACAATGATGGCGA
CTATCGCTCTAGTCGTGGAGACAATTGGTACTCCGACAAAAGCGCCGACAAGGATCGGTATGAGGATGATGATACTCACT
ACGATGGAGAGCGAGAGGGATCCGATAGCGACTCACCCAGTCCAAGACGTAACTATCGATACAATGACCGTGCGAGTCCT
GCCGAAGTAGCCAGCGAGGCCAAACCTTCCAGCCTCAACATGAACATTCGTTCGAAGACCGTCAGTTCCCCTGTCTCCAA
GCAGCCCACTTCAACGGCTTCTGCCAAGCCAGCGCTGTCCCAGAAGAAGATCGATCTGGGTGCGGCAGCAAACTTTGGAA
AGCCAGCTCCTGGCGGTGCTGCTGGCATTCACTCACCAACTCACCGTGACACTCCCACCAGCGTGGACTTGATGGGCGGC
GCTTCGCCATCGCCGTCTACTTCCAAGGCAAACAATAATACGCAAAGCAATAACAACGATCTGCTGGACGATCTGTTCAA
GACCTGCTCGCCACCGCCGGGGCAGGAGAAGACGCTGAACAGTGCTGCCGTGATTGTGGATGACGATGATGACTTCAATC
CGCGTGCCAGCGATGCTAGCCAGCAGGAATTCGGCGACTTCGCCTCTGCTTTCGGGCAGCCCTCGGCGGGATCGACGATC
AGCGAGCCACCATCAACGGGCCTGGTTCCGGCTGCGAACGATGAGTTCGCCGACTTTGCGGCGTTCCAAGGCTCGACAAC
GTCGACATCTGCGCTGGACGGTAATTTGCTGAAGACTGCCACGCCGGCGAACGATTCGTTTGACCTGTTTAATTCAGCTC
CCACCTCGACGGCAGCAGCCACAACGGCTACAGATCTCCTGGCAGGCCTGGGCGATCTGTCCATTCACCAAAGCATGCCC
ATGGACAATATGATGCCTCCCATTCCCGCCGTCACGGGCAATAATCTGCTCCAGCCCATGTCGGTGACCAATAATAACAA
TAATACCAACGGAGGCGCAGTCCCCGCCGCTGCCAGTGTCCAGTCTACCGCTGTGGGCGCCACCTGGTCGGGCGACCTGA
AGGGCGGCAAGATGAACATTGACCTGGACAATCTGCTGATGAGCAAGTCGGGCAAGCCCAGTGCCCCGGCCCCTTCGATG
AATGCCCTGAAGACCAACAGTCCGGCAAAGGCGCCACTGAATGTGCAGACGGGTGGCGGATTCCCTGGACTGTCGCCAAT
GACCAGTCCGAACATTTTTGGGGCTCCGGCACCGCAGCAAAGCATTCCACAAAACCAATCAGCATTTGCCAACTTTGGAG
CTTTCCAGCAGCAGCAGCAGAATCACAGCAATAATAACAATAATAGCTCGTCGGCATTCGACTTGTTTCAATGATATTTT
TTAGCCTAATTTAACCCAACCAACCTACTACCCAAAATGTCCACTCTCACATTCACATTTCCACGATCGCTAAACTTGTC
AGTTCTATATATTATTTACGTTTTCCTTTCCCCTTGCTGTACAAAGTTTGCGACACGTGCAATTTGTTTCTAAATTCGTT
GTTAAACAATTTACCCCCGATGCAATTTTCCGGATCAAACCCATTAATTCCACATCCGTCCTGATCGTCCACTCGGAATT
TGAAAGTCGTCATCAAATGCAATACACAGAGTAGTTGAATAATGGTTGTACTAAACGGATTCGTTAGCACAACGCGCGGA
CGGACGGCTGAGCGATCCAACATTGAAATTGTTAAACAAAATACTACACGTAATAAAATCAAACAATTTTAGCAATAGTT
AACGTTACGATGTGTCTGTATATAAATTGAATGTAAAGCAAATATGAAATATAAAACAATTGAAACC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0299516
5024
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0288789
649
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0288790
1415
Comments

GC splice donor site postulated

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
epsin-like-RC
lqfR-RC
Secondary FlyBase IDs
    References (0)