Open Close
General Information
Symbol
Dmel\CG42306-RA
Species
D. melanogaster
Annotation Symbol
CG42306-RA
FlyBase ID
FBtr0299688
Feature type
Associated gene
Evidence Rank
Length (nt)
2399
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 125 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CCAAGCAGCCACAAAACCTAAAACCTAAGAGAGAAGCAACACACCGAGATGGGGGCCATCTCCGCATCCACGTAGCCAGT
      GGAGCGCGAGGCATGGCGCATACGGAAGCCATAGGCTGCAAGAGATTTCTCTTCTTTGGCCTCCGCTCGACTTTCGGCTG
      GCTGTTGAACCCGCAGCGCATCGCTGGAGCGTGATCTCCCCGCCCCCAGATAGGCATCCCCAATCTCTCACTCTGCTACC
      TACTTGGCCGAAAAACATACTCAAGGATGCCATCGAAAATCAATCGCAAAATATGCGAAAGGAAGAGAGATGCCCAGGCT
      CCAATCGCCGAAAATTACAGGAAGCAAAAGCACTTGGCGAAACGATCGAAAATCATTCAATTACGACAGCTGGCCCTGCA
      TATAAAAAATGGGCGTGTGCTCCACAAAATATCATTATCCCGTAGGTATTTACACACAGACCAGCAACGGGCACACCAGC
      AAAGAAAAAAGTGTTGACGAAATTATTATAATGCTGCGAATATAAACAAAGGATTGCGTTGAAAACGTATTAAATACGAT
      CTTTGGCACTTACCAATCAGGCAATGAGTTTCAATTTCTACGTGGAATCGTTCAATTCAACGTTGCAGTCGATTGCGCGA
      CAAGTGGAGCAATTTGCTGGCGTTGCACTGACGGCAGCCGTCGATCTGCGCGGAAATCTGGAATCTTTGACCGGTGACTT
      TCGTTGGGAAAACGGACCCATTGCCTTCACCGATCTGCAGGCGACACTGCTGAAGGTGCTTATCGTGCTGCTTCTGGGCA
      CCTGCGTACTAGCCGGCTATTCGTGGTCCATTTACGGCAAAGTCATTACGGAGAAGTTTGTCAGGCCAAGCACGCTCAAG
      GAAATCGAGGAGCTTAAATTGTCGGTGGCCAAGTTGAAGCTGCCCAAGGAACACTCGCCGCGCATCTAGAAACCATGTCC
      AAGATTAAGAAGTTCTTTTCGCGGAAGAAGGCGGAGGCTGCCTTTAAGCTCAATTTAACTGGCAGCGGCATGGGCACTGG
      CCACAAGCTGAATTCCCCCAAACAGGAGACTCCTTCAAGTAGTTCCCGCCAAAAGTATGAGGCCTATGTGCCACCAAAGC
      GAAATGAAATAAGTAACGAGGCCAGGGCAGCTGCCAGTGCGGCACTGGCGCGCATTGACAAGAAAACATCCAGGGAATTC
      AATACCTCGCTGTCGGCAGTGAAGGCACAGGCTAAAAGAGAGCTGGAGGCAGAGCGTCGCCAGAGAGAGGAAGCCATGGG
      CACGCCATCAACGACCAGCACATCCACATCGGCTTCCGGCGGCGACACTCGCAACCTGGCCTGCGAAGGCGTCTTCTTCC
      GCTGCCCCCTAATCAGCGAGGAGATTCTACCCAAGAGCGTGTGGAAGGTTCGCATCAAAGAGTTCCTCTACCAGCAGCTG
      GAGGCAGATCGCGGCCTCACCGCCTGCCTGATCATCCACAATTGCAATGTTAAGGAGAAGGCCGACGAGTGCATTGCCAC
      GCTAATCCGATATCTGGAGAATCTTATCAAGAATCCCGAGGAGGAGAAGTTCTGCAAGATACGGATGTCCAACAAAATCT
      TCAGCGAAAAGGTGCGCTACGTGGAGGGTGCCCTGGATGTTCTGCAAGCAGCGGGCTTCAACGAGGTCCAGATCGATGGC
      GAACCCTTCCTTTTGTGGACCAAGGAGCAGACGGAGAAGGATCTCGACTTGCCCACACTAGTGGAAGCTCTCAAGAGCTC
      GGAGATTATTCCCCTGGAGCTGGATCGCAACATTAAGGTCCTACTTCCATCGCAGGCATGTCGTGTCGCCCTCCCCGACG
      AGTTTTATCGCCTGTCGCCGGAGGAGATCAAGAAAGAGCAACAGCTGCGATCCGAGGCCATTGCCCAGTCACAGATGCTG
      CGGACAAAGGCGATGCGGGAACGCGAGGAGCAGCGCAATTTGCGCATGTATCGATACGCTTTAGTCAGGGTTAAATTTCC
      CAATGGACTCTTTATACAAGGCACTTTCAATGTGTACGAAAAAATATCCGATGTGTTCGAGTTTGTCCAATCTTGCCTGG
      CGGACGAAAGCCTGGATTTTAGCTTGGTGTCCAACAGCGATGGCAAACTGGGCGATGAGGACTTGGAAAAGACACTATAT
      GACTGCAAACTCATTCCGAACACTCTGCTGCTGTTTAGCGCCAATGATACACCCGCTCCTTTGCAAACGGATATAAACTA
      CTTAAAGGAAGACCTTCTAATGCTGGTGCAGGCTATGTAGAAGTGCTTTAACCCATATATTCAGCGGTATTTGTCCCTTA
      TATTATAACAGAGCTGTTGTTATTTATTACTTTCAAATCTATTATTCAAAATCAATTATAAACGCACTTTACACAAAAG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0299689
      2048
      FBtr0340393
      1950
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0288966
      121
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0288967
      121
      FBpp0309339
      121
      Comments

      Dicistronic transcript.

      Transcript terminates at site supported by polyadenylated cDNA.

      transcript_exception: dicistronic_mRNA

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG42306-RA
      Secondary FlyBase IDs
        References (0)