Open Close
General Information
Symbol
Dmel\frc-RB
Species
D. melanogaster
Annotation Symbol
CG3874-RB
FlyBase ID
FBtr0299820
Feature type
Associated gene
Evidence Rank
Length (nt)
3871
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 173 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GCCACACTGAACATATGTTCCGGGGAGAATGGCTGCGATTTCGCGTCGGTAAAAATAGCAAATACTCGTTAATGTGCTGT
      GGGAACGCTTCCTCCCCGGCCCCAAAGTGGCCCCGAAGAAAGTGAGCAAATGTGCGCGCCGCAAGATAGTCGCCGCCGAA
      CAAACGATAGTGACGAAAGTGATTTAATTCAACTACCAGCACTCCCGCAAATACGATGAGTATGTCGCGCGGCGGCAACA
      CAACTCTGGACTTGCAGCCGCTCCTGGCGGAGAGCGATGTCGGAAACAGGGAGCTGGAGGAGAAGATGGGCGGATCGGCG
      GATCGGTCATCGCTGCTCGATGGATCCGGTTCGAAGGAGCTGAGTCACCGGGAACGCGAGGACTCGGCGTTGTTCGTCAA
      GAAGATCGGGAGCGCCTTGTTCTATGGCTTGTCCTCCTTCATGATTACGGTGGTAAACAAGACGGTGCTTACCTCCTACC
      ACTTCCCCTCGTTCCTGTTCCTCAGCCTCGGGCAACTTACTGCTAGCATTGTGGTCCTGGGCATGGGCAAGCGCCTGAAA
      TTGGTGAACTTTCCCCCTCTGCAGAGGAATACCTTCGCCAAGATCTTTCCGCTGCCACTGATATTTCTGGGAAACATGAT
      GTTTGGACTGGGTGGCACAAAAACCTTGAGTCTGCCCATGTTCGCAGCCCTACGACGCTTCTCTATCCTGATGACCATGC
      TGCTGGAGCTCAAGATCCTGGGACTGCGACCTTCGAATGCGGTTCAGGTCAGCGTATACGCAATGATCGGTGGAGCGCTG
      CTGGCCGCCTCTGATGATCTGTCCTTCAACATGAGGGGCTACATCTATGTGATGATCACTAACGCCTTGACCGCCTCGAA
      TGGCGTATATGTGAAGAAAAAACTCGACACCTCGGAGATCGGAAAGTACGGCCTAATGTACTACAACTCGCTGTTTATGT
      TTCTGCCTGCCCTGGCCCTCAACTATGTTACAGGGAATCTAGATCAGGCGCTGAACTTTGAACAATGGAATGACTCAGTG
      TTTGTGGTGCAGTTCCTGCTCAGTTGCGTTATGGGTTTCATCCTATCGTACAGCACCATCCTGTGCACGCAATTCAACTC
      GGCGCTGACCACCACCATTGTGGGATGCCTGAAAAACATCTGCGTAACATATCTGGGCATGTTCATTGGAGGCGACTACG
      TCTTCTCGTGGCTCAACTGTATTGGGATCAACATCAGCGTGCTGGCTAGTCTGCTCTACACGTACGTCACTTTTCGGCGG
      AAGCGGGCTCCCGATAAGCAGGACCACTTGCCCAGCACCCGCGGCGAGAATGTCTAGCTTCATCTTAGCTCAAACTCAAG
      CCAAAGCCATACGATATGTTAAGTGTATTCCGTACTGTGTACTTCAATTGCGATCTGCGATTCGCGACAACGTTCGTATT
      TGATTTTCCTACAACCACACAGCGCATCGTCTCTGTACATATATCTAGCTATATTTCTATAAAAATGTAATTTAGCAATT
      ATGTAATTTTAATCACTTTGTACATTTGTCTGCATGCAACTGTTTCCTGCATCGAAAGTGTCATAAGAAATAGAAATACA
      CAGACTTCCACTCCTCCGCCTACGGAATGGGTGGGCCAGATAAACAATTGTGTTCCGTCTTCTGTTCCATTTTGGGTCAT
      AATTGATAAGATTGCCTGCTCCGATAAGGCATACAACTCGGACGTTGCAAATTAAGCAGACATCTTGCTCTCTCTCACGT
      GCTTTTCTAATTACTTTTTTGTGTAAAATAAGTAATGTAGTGGAACTGCGTTGTGGGATTTGCCAATTACTTGTGCTTAA
      TAGGTTGTTGTTTATCTATTCTGAGCAAACACGTTGGCGCCTTGAGATTAATACAAAACAAAGTACTGCATTGCCGGACA
      ATCCAGCAGCGTCATCACTCAACATCACTATGTAAAAAGCTTTGGATAGGTTGCTCGATTACTGATTACTCTATATCAAA
      ATTTTGGGTTTTTATGTTGAATAAAAAAAAAACAATATTATCAGCCAAGAACGTGATTGCGAGTGGTGATAGTATTTTTT
      AGAATAGTACGCCTTCCGATATTTTGTGTTATTTTCCGTTTCATTTGGTAATTGCCTCAAAAGGCTTTTGTTTAGATTGT
      AGTGCTGAAGAATCTTTTTCTTTGTCTTAAAAGTAAATAAATTTGCGCAGCTGAAACTGTTTTGTTTTAGCGAAATAAGT
      ATGTATACTTTAAGATGGCTATCTATTTTCTTAGAATTAGATTTTACTTGGTAACTGCCTAGTTCCTTATCAAAAGATTA
      AGATTTAAATATCCCACATATATGTTGCTAAACTTATCTTTTAAATGGTGACTACTCATTTATCCAAAGAAACAACAATG
      ACGACATTGAATCGGGCATAAAGCGGCAGAATGAGGTGCTAGTGCCCCGGCAGCACTTTGTTTGGGTTATTTTGGGAGCC
      CGCAATATATGATGGGCGGTGGTGAAGTGAGGGATTCGGAGTGGGGACAGGTAATGAGGAAGCCGAAACAGGTTTGCACA
      GACTTAGCCGTGCGGTGAGGTAAATTGTTAGTCAGCATCAGCCCCGACCGCGTACCCACATTATGGACAAATTGTTTGCT
      CATATTCGCCGCTATTGAAAGTGGGCACGTACATACGTACGTATGGCTCGAGGGACCAGCTTTAACCGAAGACAGGTAGT
      CAGGGTCATGTTTGTGTGCGACGATGATGATGATGATAATAATAATGTAATGATGATGATGCCGACGATCGTGCTGATAA
      GGTCACCACCGGGTGCACCTCCCCATATCTCCTCTATGAATCCACAGATCATCATGATGCAACGCTGTTTGCGTCTCCAA
      AAGCCGCTGGCCCTACGACGAGGCCTTCGCTTGGCCCAGGCTAATAGCCAAGCGGTGGCCACAGAAGCACCCGAGGCGGA
      ACCTCTGGATGCCTTCGAGCGTCAGTACCTCAAGGAGCGAATCGAGATATCGCCCTTCCAGCGGCTGTTCCTGGGGGCAG
      GATCCTCCATTGCCGCGCTCTTGAATCCAAGACGTCATGACATGATCGCCTGTTTGGGTGAGACGACTGGAGAGGATGCT
      CTATGGACAATTTTGGACACCATGCAAGCCAGCGAGGAGGGTCAGCGCATCATGGCTGATAAGCCCCGCATCCACACCAG
      CACCATTGACTTCAAGTATCTGGAAACTTTGCCACCGGATACCTTTGGAGCCGCTTACGTAAAGTTTCTGAAAGATAATC
      AAGTCACGCCGGACAGTCGCATGGCCGTGCGGTTTTTGGAGGACCCGAAGTTGGCCTACTTGATGACGCGATATCGCGAA
      TGCCACGACCTAATCCACACGGTGCTGGACATGCCCACCAATATGCTGGGCGAGGTGGCTGTCAAGTGGGTGGAGGCTCT
      GAACACGGGCCTGCCCATGTGCTACGGTGGTGCGGTATTCGGAGCAGTTCGCCTACGTCCCAAGCAGCGGCGTGCGTACT
      TGAAGCATTACTTGCCGTGGGCCCTGGAGAACGGCAAGCGGACCAAGCCCTTGATGCCCGTCTACTGGGAGAAGCGCTGG
      GAGCAGAACATCCACGAGCTGCGCTCCGAATTGGGCATTACTGTGCTGAATAAAGCTTGATAAGGCTGTTTATTTTTAAG
      CCCATTTTTAAATTTTGAACTTATCGACTATTAGTATCGAGCAGTCCTATCGCGATCGTAGAATTGTGATCTGGCAACGT
      CGTGTAACGTCGAACTGATTGTAGATGTTTCCACTTACAAAGAAAATTATTATTTGATTATAGCAATAAATATAAAAGTT
      GATGCAGTTTGCCGAAATAATTTAAAGATCG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0075228
      1609
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0289098
      373
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074990
      373
      Comments
      Dicistronic transcript; alternative monocistronic transcripts exists.
      Transcript terminates at site supported by polyadenylated cDNA.
      transcript_exception: dicistronic_mRNA
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      frc-RB
      Secondary FlyBase IDs
        References (0)