Open Close
General Information
Symbol
Dmel\kis-RC
Species
D. melanogaster
Annotation Symbol
CG3696-RC
FlyBase ID
FBtr0299837
Feature type
Associated gene
Evidence Rank
Length (nt)
18528
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 56 )
Sequence
AAATGGAGGTCTTTGATGTGTGTGTCGCGTTGTCTTGAAATTTGCTGCTAGAATTTTGCGTTAAACGCTGTGAGCGAATG
TGTTTCACTGCGAATATGTCAAAGGTCGGCCATGAAGTGCGCGAAACACGAAACACAAATGACTTTTACCCTATAAAAGC
AACAACAAGACGTTAAATTGCACACCAGTTGTAATTAAGCTTAGTAGTTAGAACCAACAACCAACTAATATATAATCATA
ATCGATAAGGCGAAGGTGGATTGAGACACCAGAGACCGACCTGATCCACGGGGTAAAGTGAGAAGTGAGGAACAAACATC
TTATCCCCTGAGAAGTGAAACTTCTCCGCAATTGTCTGGCTCTCAATTATCGACTACATTTAGGCTTCCGACATTTTGAC
AACGGCCACGCGCAGAAAGCAGCATCAAAATTAAGCCAATTGACGACCAAATCTGAAACGCAGCGGCGTCGCGTCTTTCG
ACGCGTAACGGACATTTCTGTGTGCGCTGCGTTTAAAAAATCTGATGGATGGAAATGCACAAAATATGTTTCACGGAAAT
CATCAAGGAGATCCCTATTACCGTTATGATGCGGCAGCTGCCGCAGCAGCCGCAGCCGCGGCGAACCCGCGTGCAATGGG
ACCGCCTGGCGGCTATCCGCCGCGCCACCGCCCCCCACATCCGCTACAGCAACAGCCCCAATACCCATCGTACCAGCCAA
CGGCGGAGAATCTCTACGGGCTGGGGGCCGCCGATCACCAGGCGGCTATGGGCCTCGGCGTTGGAGTAGGAGTTGGTGCC
GGAATGGGCGATCTAAGCGGTTGGGGAGCGGCGCCCTCGGTTCCGGGCCAGGCAGCGGCTTATCCCGGAGCCGGACTGGG
GGCCTATGGGCATCCGCAAGCGGCTCCACCGTCGCAGCAACAGCGTCAGAGCAACGCTAGCGCATATCGTCAACACATGC
CCGCCTATGGACAACAGGACCAGCAGAAACTTGCTTCATACGGCGCGCAGCAGAGCATGATGGCGGGGTACGGATCACTG
GCGCCCCAGCAGCAACAGCAGCAGCAACCGCCCACGCCCCAGCAGCAACAGCAAGCACAGCAAGTGCAACAGCAGGCGCA
GCAACAACAACAACAGCAGCAGCAGCAGAGTCAGCAGCAGGCTCGACTGCCGCAGCATTATCCGCAAGCTCCTGGTCAGC
ATCCGTTGTATCCTGGAGTGGGAGCACCCACCGTCCAGGCGGGACAACCTCCCACGCCTCAAGCTTATGCTCACAGTCCG
TACGGAAGTCCCATGCAACACCAACCAAGTAGAGGAGCTCCCCAGCATGTGGGCTACGGTCATACAGGACTAGATCAGGC
TTCTGCTTACGGACAGCATGTGCCGGGAGGAGCGCCACCGGGTCACCACTTGTCAGCGCAGCAGCAGCAGGCTGCGCAGC
AATTGGGTGCCCACCAGCAGCAGCAGCTCCAATCGCAGCAGCAACAGCAGGCCCAGCAGCAGCAACCTCACGTCTCGCTA
ATGCAGCAGCAACAGTTGCCGGGTGCTGGATTGCCGCCGCCGCACATGGGAATGCCTCCTAGTTACGGAAGCCACCATCA
ACAGCAACAGCAGCAACAACAGACCCAGCAACAACAGCAGCAGTCAGCGCCGCCTTACATGTCCAGCAGCAAGCATCAAC
AGGCGGCTGCCCAGCTAAATTCCTCGCCCCAGTATCGTGCACCTTTCCCTCAGCTTTCCCCACAAATGTCGCCACGTCCT
CCGACAATGTCGCCGCACCCACAAATGTCCCCGCGACCAGTTGGCGTGTCGCCGGCGAAACCACCGCCCCCCCAACAGCA
GCAACAACAAACGCAAGCGCAGCAGCCGCAACAGGTTGTAAGCAATCAGCCAAGCCAGCACAGCATTCAAGGCATGGTAG
GCCTGCCATCGCCACGCCCACAGCCGCCCACAAGTGGAGCAGGCGGAGCGGGAGCGAAGGGTCCTGCGCCAGTTGCTGCT
CCCGTTAACACATTACAGGCCCTCGAACAAATGGTGATGCCATCTCAGGCTCTCGGACTACCACCCATGGACTACCCATC
GGCTTACAGAAGTGCCGTGGGTCCTAGGATGCCAGCTTCCCCTCAACAGCAGCAGCAACAACATCAACAATGGGGGGCGG
CTCATGGAGCACAGCACTTGGCGGCCCTGCAGCAGCAGCAGGCCCAACAACAACAACAGCAGGTACAACAGCAGCAACAA
GCACCTCCGCAGCAGCAGCAACAGGCGGCGATGTTGCAGGCTCAGCAGCAACATCACCAGCAGCAGTTAAGCATGTATGG
TCAGCCGATGGGACAGCAACCACAAACCGCGCAGCAACAAGTTGTACCACCGGTGACTTCACAACCGCCAGTAGTGGCCG
CCTCTCAGCAGCAGCAACAACAGCAACACCAGCAGCAGTCACTCAACGATCAATTGCAGCACTCGATCAACGATATTGTT
GGGGGTGGTAACAGTAGTGGAGCAACAGGGGGTGCTCAGAATCAGCACCAGCAGCAACCCCAACTGGCGGCCATGTCTTC
GCCGTTGCATCAGCAAAATCTGCCTAACATGCACCATTTAATTCAACCTACCATGGAGACAACACAGCCGACGCAGCAGC
AACAGCAAACGTCACAACAACAGCAGCAACCACAGCAACCGCAGGCGACTTTAACATCGCCGCACCACCAGCAAATGCAG
CACCAGTCTCCAATACACCAGCAGCAACAGTCGCCGCACCACCAGCAACATCTACCCAGCTATAATCAGTCACAGCAGCA
ATTTGATCCCTTCGCTAACATACTAGGAGACAATCAACCGGCTGCATCCCAACAGACAATGTCGCCCGCTCATGTAAGTT
CGCCAGTACCCGCGCAAATGCAACAGCAGCAACATCAAACCCAACAACAACCATCCCAACAAGTACCACAAAGCCAGCAA
CAACAGGTGTCGCAGCCGCAACAGCAAACGCAGCAGCAGCAACCCTCGACCCCATCACATCACCTGAGCAGCATTCTCAA
TGAAACAGCCAACTCGAATGATTCCTCCACTCTGGCGGTGGCTGCTAATGACAGCAACAACAGCAGTAGCAATAGTAGCA
CCAATAGCATTGTCAACAACCAGCCCACGTCGGTGCACGACAGTAATTCGCAAAGCAGCATTAACAGCAGCAGCAACAAC
CAGCAACAGTTGCTCATGGACAACACGAATTCGCACGGAGGAAATTCGGAATCGGCCCAGAATGCTGGAGTAGATGTTGG
TCTTTTTGATAACAACTCGATGTCTTCAAATTCAGCGGCAGTTGCTGCCGTGGCCTCCAATGCAGCTTCTGCAGCAGCAG
CACTTTTAGATAGCAATTCTCAGTCCTCGAATGCGGAGTTTGAGAAGAATCAAAGCGAAGGTGAGGGACTCGGTGTTGTG
GAAGGAGTTATTGCCAATGAAACTGATTTGCCACAGGATGAGAACAGTGTTTCTAAAACTCAAGACATAACTCTAAGCAC
GGAATTGCCAACAATACAAGACGATCTGCAAGAAAAGCCCACCGCTGAGATGGAACAAACTCAATTGGGACAATCTTTAG
GGGATCTATCTAAATCTTTGTTAGAGGAACCCAAAACAGTGGAGGAATCCGGAGAGGATAAATCTCAATCGGCCCCTGGA
GTTGCACCCCCTGCAGATCCTATTATCCCCGTTACACAACCGCCTCAGCAACAGATGCCTCCTATAGGGATGCCTATGCA
TCCTATCGCCCCCGGATATGAGGCCCAGGCTCAGGGACAAGGGCACATGCCTCCCATGATGCCTCCGTATGGAGGAGCGC
CAGGAATGTATCCACCTTATCCGATGCTGCATCAACAAGAAATTGCTGCACTGCAGCAGCAGATACAGGAACTGTATTGC
ATGCCTCCAGGACATGAGCTTCAACACCAAGATAAGTTAATGCGTATGCAGGAGCGATTAAATCTTCTGACGCAGCACGA
GGTAAACGATCAGTGTGCTGGCGGTCCACAGTGCTTATTGTTCCAAAACGTTCCGCCAATGTATGGACCACCAGGAAACC
CCCTGCTTAACCAGCAAATGGTAGAGAGCCCTCAAGTATCTAGCACCACGGGAAGAGGTCGAGGAAAGAGTGCCAATAAG
CCGCGTAAGCCTCGCGCCAAGAAGGGTGAGAAAGCCCAGGTGGGTCAGCAGCAGGATTTGATGGACATCAGCGGCAATGT
GGCAATGGGAGCAGCCAACGCCGTTTCAAGTATTCCAACGACACAACTACCCGTCTCTGAGGATTGCGTGACTCAAGGAG
CGGGAGATACCAGTGTGGTCGGTATGCTGGAGTATAGTGAAGGGATGGGTGATCTCTCTCAAGATGTGCACTCAGCCAAC
GAACTGGATACCTCGACTGATGGCAGTGGCAAAAAGAAGAAGCCCCGCAAGCCTAGAACACCTAAGGATCCAAATAAACC
CCCACGAGATAGAACGCCGAAGGCGAAGAAGCCCAAGGATCCAAACGATCCCAACTCTACCGAGACACCAGCAGCGGTAA
AAAAGCGAGCTGGTGCTAGTAAACGCAGGAAACAGTACGGAGAAGATGGGGCTGAGCAAACGGGAGAGGGTAGCGAAGTG
GAAGACAACAAGCCATTGGTACCAAAAGCAGGATCTGCTGATGGTGAAGCTGAAACCACTTCGGGAGGAACTGGAGTGGA
TGGAGAATCTCCAGACTACGATGACATTCCCGTTTCAAAAATTCCGCGTGGCTCCAATGAAGATGAAAAGGAAGCGGAGG
CCGGCGATGAAACAGTAGACTCTGTTCCAGATTCGGCAGGAGATCCTGCTTCTACACCAAGCAGAAGAGATCGTAAAAGA
TCCACTGCAAGGAGTCGCCGCAATGCAAATTCTGAGGAGGGTGGCAGTGCTCGCAAGAACCGTGGATCTCTTTCCGCCAA
GGCACTAAAGAAGCGAAGGAATAGGGGTCGCATTGTACCTGAATCCGATGGCGAAGATGACACACTGGACAGAACTCCAC
CTCCATCACCGCCACCAGACTCTGAAATGGATTCCAACAAGCGAAGATCGTCAAGGAATACTCAAAGAAAGAAATACATC
GATGATGTTATGCTAAGGTTCTCCGATGATGAGAACTCTCTCTTAGTGGCATCTCCCGTAAAGAAGGATAAGAAACCATC
TGCGAATGCGAGTAATTCAAATGCAGGAAGTGATGTGGAAAAAACGGAACCTCAATCTGGTGCCGAGGGAGACGCTGCCC
AGGAGGTGGGTGAAGAAAAGTCAAATCTACCACTGGATGAAAGCAGTCAACTGGAAGCCAGTTCGAGTACTTCTGCAGTA
GCGGAGAAGGAGCGACAAATCTCTACTGATGCTGCAAATGCAGCCATGTCTTCCAAACCCAATTACGTGTACATAAACAC
TGGCGATGAGGACAGCATGGTGGTTCAATTAGTTTTAGCCATGCGAATGGGAAAGCGCGAACTTATTCTGGACAAACCCA
AAGAAAAAGCACCCGAACCTAAACAAGATGAAGAGAAATCTGAATTAGATGAAGCCACTACTGATAAACCTGAGGGAGAT
GAAAAATTCAAAACTGAGGGTGAATCCAAGAAAGATTTAACCGATTCCGAGGAAACGAAATTAGAATCCTCCGCAATGGA
AGTAGACAGTAAGGAAGAATCTGAGCCTGATGATTCTAAGAAATCGGATGAAGACAATAAGGACAAGGACAAAATGGAAG
TAGATGATGAAGTTGGAAAATCAGATAAGGAAAGTAAACCAGAAGAACAATCAGAAACAGTGAAAACTGAAGAAAATTCT
AAAGCCATCGAGGAAGACAAGTCCTCTACCGTTTTAACAGCAGACCACGCCAAGGAACCTGAGACTGTCTTGGAGAAAAT
GGAGGTTGATGAAAAGGCAAATGATGACCAATCGGCTGTATCGAAAGCAGAGGGATCTGACGAAAAATCTACTGATGACT
CCAACCCCGAAGAGGCTACTACAGAAAAGAATAAGGAAAGTTTAGAAATTGAAGGGGAAAAGGAGCGGGTCAAGGAGGGA
GAAGAATCCGTTAAGAAGGAGAATGACGAGAAAACAGAAGCTGATATGGAAAATAAGCCAGAGCCCGTCTTTATCGATGT
GGAGGAGTACTTTGTGAAATATCGCAATTTCAGTTATCTACATTGCGAGTGGCGAACAGAAGAGGAACTATTAAAGGGTG
ATCGCCGCGTAGCTGCTAAGATTCGTCGCTTTCAGCAAAAGCAGTCTCAGCAATTGAATATATTTGAGAATATCGAAGAC
GAGCCCTTCAACCAGGACTTTACTGAAGTGGATAGAGTGTTAGACATGTCTGTGCATACAGACGAAACCAGTGGAGAGAC
TACGAAGCACTACCTGGTCAAGTGGAAGTCGCTTCCCTATGAGGATTGCACTTGGGAGCTAGAAGAAGATGTAGATAACG
ACAAAATTGAGCAGTACCTGCGCTTTAACAAAATCCCTCAACGGAGCGAGTGGAAGTCTAAAAAACGACCGCATCCAGAA
TTGTGGAAAAAACTGGAAAAGACGCCCGTCTATAAGGGAGGAAATAGCCTTAGACCCTATCAACTTGAGGGTCTTAATTG
GTTGAAGTTTTCTTGGTACAACACCCACAACTGCATACTCGCTGACGAAATGGGCCTTGGAAAAACTATTCAAAGTTTGA
CATTTGTGCACTCTGTATATGAGTACGGCATTAGAGGACCTTTCTTAGTTATAGCTCCTCTATCTACAATTCCAAACTGG
CAGCGAGAGTTCGAGGGCTGGACGGATATGAACGTAGTTGTTTATCACGGCTCGGTGACAAGTAAACAAATGATACAGGA
CTATGAATATTACTATAAGACAGAAAGTGGAAAGGTATTGAAGGAGCCCATCAAGTTTAACGTTTTGATCACCACTTTTG
AAATGATCGTGACAGACTACATGGACTTAAAAGCCTTTAACTGGCGCCTTTGTGTGATTGATGAGGCACATCGTCTTAAG
AATAGGAATTGCAAACTCCTTGAGGGTCTGCGACAGTTAAATTTGGAGCACAGAGTATTGCTCTCCGGAACTCCCCTACA
AAACAACATCAGCGAGCTGTTCTCGCTGTTAAACTTTCTGGAACCCTCGCAGTTCTCCTCACAGGAAGAGTTCATGTCTG
AGTTTGGAAGTCTTCGCACTGAAGAAGAAGTAAATAAGCTGCAAGCTCTACTGAAACCAATGATGTTACGTCGTCTAAAA
GACGACGTAGAGAAAAGTTTGGCGCCCAAGGAAGAAACCATTATCGAAGTGGAGCTAACTAACATACAAAAGAAATATTA
TCGAGGTATACTGGAACAGAACTTTAGTTTCCTGAAAAAGGGGACCACATCTGCTAATATCCCAAACCTTATGAACACCA
TGATGGAGTTGAGAAAGTGCTGCATACACCCTTATCTCTTGAATGGAGCGGAGGAACAAATCCAATATGATTTCAAGTCC
CAGCATGGCGAAGATCCTGAGTCCTATTATAAAAATCTGATTCTTTCCGCTGGTAAAATGGTTTTAATTGATAAATTGCT
ACCTAAACTAAAAGCAAACGGCCATCGCGTTCTAATATTCAGTCAGATGGTGCGTTGCTTGGATATCCTTGAAGATTATC
TAGTGTACAGAAAATACCCCTTTGAGCGAATCGATGGGCGCATTCGCGGTAATCTCCGCCAGGAGGCCATCGATCGTTAC
TCCAAGCCAGGTTCCGATCGCTTTGTATTTCTCCTTTGCACCAAAGCTGGTGGATTAGGTATTAATTTAACAGCTGCTGA
TACTGTTATTATTTACGATTCGGATTGGAATCCACAAAACGATTTACAGGCTCAGGCCCGATGCCATCGTATTGGCCAGA
GAAAGATGGTAAAGATTTATAGATTGCTTTGCAGGAATACCTATGAGCGTGAAATGTTCGACAAAGCTTCAATGAAACTT
GGATTGGACAAGGCTGTATTGCAGTCGATGAACACCCAAGGGTCTAAAGATGGCAATAACAAGCAGCTGTCCAAAAAAGA
AATTGAAGATCTTTTAAAAAAGGGTGCTTACGGGGCCGTCATGGATGACGACAATGCTGGTGACAAATTTTGCGAAGAGG
ACATCGATTCAATCCTTAAGCGACGCACTCAAGTCATCACAATGGAATCGGAGAAGGGTTCAACCTTCTCAAAGGCTTCA
TTTGCTGCATCCGGTAACCGGTCGGATATTACGATAGATGATCCTGATTTTTGGACCAAGTGGGCCAAAAAGGTTGACAT
TGATCCCGATGCTTGCGAAAGGGATGAAACGGAGGACTTGGTTTTGTCCGAACCCAGAAGACGCACCCAAATCAAACGCT
ACGGCCACGAGGACGTAATGGAGCTCAATTCCGAGGAATCTTCCAATGAGAATAGCGACGAGGAGGGAGGAATAGGGCTC
CGTTCCCGTCGCCGCAAGGAGAAGCGAGATCGTGCTCGTGAAAAGAAGGGCAACGATGAATACATTCCACGAGAACGGGA
TGCATTAGCTGCTTTGGGCTTGGAGGAAATTCAATATGGTAACTGGGCCAAGTCTGAGTGCTTTAAAGTGGAAAAGGGAC
TGCTTTCCTTTGGTTGGGGCCGGTGGTCGGAACTTTTGGAGTTAGGACAATTCAAACGAGGTTGGCGTGATGTAGACGTC
GAGGATTGTGCTCGCATCATACTTCTTTACTGCCTGCAGGTGTACAAGGGTGATGAGAAAATCAAGACGTTCATCTGGGA
CTTGATAACACCGACGGAGGACGGGGAAGTGCAGAAGATTAGCAGGGATCATAGTGGCCTACACAACTTGGTGCCACGAG
GTCGCAACGGTGGAAAGTCAAACAAAGAATCCACAGGAGTGTCTACTCCTGCTCCGGGCTCTGCATCCGGAAGCAATAGT
GGAAACACGACTCCGGCTCACAAATCTAGTGCGCTGGATGGGTCCGATAAGGACAGCGGCGGCATAAATGCCAGCGCAGT
AGCCGCGGCGGTCACAAGCATTCACGATCCAAATCACTGGAGCAAGAAGGAGAAGTACGACGCTGATGCGTACTTGGAAG
GCGCCTACAAGAAGCATTTAGGCAGACACGCCAATAAGGTTTTGCTGCGCGTGAGGATGCTCTATTATATTCAACATGAG
GTTATTGGCGACTTTGTTCAGCAGATAAAGGACAACACGCCTATCAGCGAACTCCCCATTCGCCCGCCGCCAACGCCAGA
TCAAGTGCCATCTTCATGGTGGAATCCCATTTGTTGTGATAAGAGCCTGTTGGTGGGAACCTACAAGCATGGCTGTGAAA
TGTATCGTCAAATGCGCGCCGATCCCAATCTGTGCTTTGTCACCCATGTGGGCGCCGGTGCGGCCGGTGACGATCTGGCT
GTCACGAGTTTGCCGATAAACGAAGACGATGCTAATTCGAAGCACGATGATGGTGACGAGGTGGACGATGACGGAACTAC
AACGACCAAAGACTCTGACTCTACTAAACTCACCGGGGGCGATAACAAGGACTCGCTTCTCGACCCGGAGCGTCCCAGTT
CGTCTGGTAAGAGTAGCAGTGAAAATGCTAGCGGCGGCAACGACAAAACGGAAAGCGAAAATGATGCCACAACCGTTTCC
GAATCCTCATACAAATCCGAAGTCTTGCCGGGCAAAGGCAGCGATCTGGATGTGTCGGTCGCCCAGCAGGACGCATTATC
AGCAACTCCTGAATTGGCAAATACATCAGATCCTAAAATGAATAAAAATGACGCACAAGTCTCAGCCTCTGTTTCCTGCG
ATCCGGCCGACTCTAGTTCACCCGAGGCGGCAGGAAAAGCTCAGGGGACGGGGGTCCAGACTGGCGATGCCGGAGAATTG
GACATCGAATCGGAGAAAAAAGATAACGAAAAGGAAACCAAGGAGTCAACTGGTGATGCTCCTGCTGTGGAAGCCAAAAA
AGATAGCGCTGCCATTGCCCGAGCTGAAGGCGATAAAACGGAATCATGCACTAACAATGCTACCACAAACATCTCCACCA
CCACTACTACTACTACCATTACCAATACCACCACCACCACCAATAATCCATCATCCAAAGCGGCTAACTCTAACAACACC
ACCGACCATGCTAACTCAAACTCACATTTAGGCTTGGACGAGGAGGAGAGTGTCGCCGGCAGCTATCCGCCAACCGTGGC
AGCCGTCGAGGACGCCACTACTATGTGGCCATCTATGCAGGACCTTAACACGCGTCTCCGGCGGGTGATCACTGCCTATC
AAAGGAATTACAAGAAAGAGGAATTAAAACTGCAGCAGAAGGCCAAGCTCCAGGCATTGGTTTCATCGACACCGCCGCTG
TCGGTTCCCACCACTCCCACCCTTCAGTCTATGCAAATGCAGCTGCAGAGCGGCTCCGGCAGTGGTGGGTCCGGAATAGG
ATCCTCTGCTCAGCACGATGCCAGTGGCCGGAGTCTTCAGGCGTTGATGCAATCGCAGGGGGCCAGCACATCCGCAGCAG
CAGCCGCCGCCGCATCAAGTGCTGGAGGATCCTGTAGTGGATCCGGCCAGGTGGGCATGGGCGGAGCGGGAGTCATGCCA
GCTATGCCAACCGCCGCCGACATAAGCCTAATGCTCAGCATACTCAACACCACAGATGTCAACCAGCTGGCCAACTTGGA
CATCAATAAATTGGCCATGTACCTGGTCAGCATGAACAATAAAATGGAGCGACAGGGAAAGATGGAACTGGCGGCGAAGG
AGCGCGAGTCCCAACGGCTGCAGCTCATTCCCAAAAAATGGAACCGCCGGGAAGAATACGAATTTCTTAGAGTTCTTACC
GGGTATGGTGTGGACCTACACGTCTCAACACCTATGGCTTCCTCTAATGGAAGTTCCCTTTCGCCCGACTGGACCAAGTT
CAAACAGATGGCTCACCTAGAGAGAAAAAGCGATGAAACACTGACGGACTATTATAAGGTATTTGTGGCCATGTGTAAAC
GACAGGCGGGTTTAAAGCTCTCTGAATCGGAGCGCGGCTTAGAAGGTATCATCGAAGAAATCGAAAAGGAACACGCCAAG
CTCATACTGGATCGCTTGGAAGTTCTTGCCAAATTGCGAGAAGTCGCTCGGAATCCCATGCTTGAGGAACGCTTAAAACT
CTGCACCAAGAATGCGGATACTCCAGATTGGTGGGAGCCCGGTCGACACGACAAGGAATTGATTACAGCCGTCCTCAAGC
ACGGACTTTATCGCTCCGAAACCTTTATCTTTAACGATCCAAACTTTAGTTTTGGAGAGTCAGAGAAGCGTTTTATTCGA
GAACTAGAAGCTCAGATTCAACGTACTATCAAACTGGAGGCTTTCAATGCTGAAAAGGCAGAGAAGTTAGCGGCAGCTGA
AAAAGATGCTGCAACTGAAAAAGCTGCGGCGACTGAAAAGGCGGCAGCAGAAAAGGCAGCTTCCGTGAAGAATGAGGTCA
TAGACCTTGATGATGAGCTCATGACTAATGAGAGTGTCATAAAGAAAGAATCGCCGGTTACTCCCATAAAAGAAGAAATT
AAATCTGAAGAGAGTCCTGAAAAGCATGATACTGCTGATAATCTCGAAGATAAAAATTCAGATGCTGAAGAGAGTACAAA
GATAAAGGGTAAAGAGGATTTTAATCCAGAAACCACGGAAAAGGAAGCACTGGACGAATCTACAAATTTGAATAAGGATA
AGTCTAGCACTGAAACATTGGTTCCAGAAATTGAAGATAGCAAACCTAGCGAAGATAAAATGGAAGTTGAGGAATTGCCC
GTTGCCGAAAATGGTGAGAAGGAAGGTTCGCCTGAGAAATGCAGTGATGCTGAGGATAAGAAATTTTCAGAAGAAAAGCC
AAGTTCCCCTGCAGTTCCTGATGGTAAAGTGTCAGAAATGGAGGCAGATGAAGCTGCCCCTAATACAGAAGAAAACTGTT
CTGGGGATTCGGAATCGCCCGAAAAGGAATGTGAAGACAAGGTTGTTGAAAAGGTTGAGGAAGAGAAGGGTGAAAACTCA
TATGAAAAGGCTGAGGAACAAAAAGAAGAAACGGAAAAACTGGAAAAATCGAGTATAGAATCAGAGCCCTCTGAAAAATC
TGAAACTGTCCTCGAACCCGAAGTAGCTGTGCCCAAAAAATCCACTGGCGACCAAGACATACTCGACCTGGTGGCTGGTC
CTTCAGATCCCGATGATGACGAGGTGATGAAGGAAAAAGAGAAAGCAGTAGAAGAAGAATGCAAGAAGCAGGCAGCAGAA
CTTAAAGCCCGCTTTCCGGACTTGGAAGTGATTCAACCGGCAACTGTTAAGCAGCAAAAGTTGGAGAAGCCAAAGCTTGA
AATGTGCATGATCCGATGGTTTAAGGATTTTGCGTTAGAACGCCGTATTGCGCACATTGTCGCTTGCGTTGAGTCAGGAA
ATTGGCCTGTGGATAGTAAATACAGTGCCTTTGCAACCTGCAAGGGGGCCACTGATCTAAGCATTGCTCTTCACGAATCC
ATTCCTCACTTGAGCAGTTTGGAACGTCGCTCCACAACACCCGATGTCATTACCATAACAACGGACCAAGGTGTCACAAA
GCACTTGCAGACCTCCCACATGCAGCAAGTTGCCAGCTCGGCGTCCGCTGCATCCACTTCCTCGGGAGTTCCCCAGGTCA
CCCAATCAAAGCCCTCTTCTTCCAACAGTTTACCTGGCTTGGATGCTAAAAGCATCAATGCTGCTGTGGCAGCGGCCGTT
GCGGCAGCTGCAGCAGGTGGAAATGCCACCTCCCTATCGTCTCTGCTTCCCGGAATGTCACTGAGTGCAGCAACTGGCTC
TTCGGCCGGTGGAGTGAGCGGATTGAGCGTTCCGAGTGCCGGGTCTGGAGTGGGAAAGAAGCGCAAGCGACACATCGCCA
TTGACGTGGAGACGGAAAGGGCTAAGCTCCACGCTCTGCTTAACAGTTCTACAATGGCGCCGAAAGACTGGGAGAGTGAG
ATTGCAAACATGGAGGCCTTGAGTGGCTCCTCTGGTCGTGGTCGAGGTGGCAATTCTTCTGCTTCGAGTGGCATGCAGCC
GCCTCCAGCTCATCAACATGCTTCACTCTCGCGACAATCATCTGGACAGTTCAGCAAGCCAGCTGTCCCCGCAATGAAGA
CTCCTCCTCCCTCAATGGGTGCACCAATGGACCTTTCATCAAGCCTGCCGAAAATGAATATGACTGAGATGCTTAAGTCG
GCTTCCAGTTCGGGAGCCATCGATTTGAGTGAGGTTCAGGACTTCTCTATGCCTTCTAAGAAATCCAGTGTACATGCTGC
TTTAAGTTCCGCTTTTCCCTCGATGGGAAACAAGAGCAAATTGGACGACACGCTTAATAAATTGATGAAGAAAAACAATT
GCACCATTGAAGAGCCTGTTATTGGTAAGGAGAAAAAGAGGAAGAAGTTGGACGAGATCGTTCTCGGCCTATCGGCTGCT
AAAGAGCAAAAGACCTTCCCTGACCCATCTCTGCCATCATCAAAGAAACCGCAGATCCCTCCAAGCGTATCGGTGACGCC
AGCAAACCTTCAATCCTCGTCCAACCAGCAGTCAAATCAGAAACCCTTTACTATCACTGTTACCACAGTGCCTGGAAAAT
CCAAGAGCGGCTCGTCCAACAGCGGATCCGGCACAGGAGGAAGCTCGTCGGCCAGCGGCGGAGGAGCCGGCGGCAGCGGC
TTGAGCGCCCTGCAGAATATGGCAATGGGAGGTCTGTCATCCAAAGACAGTCTCAATGCCCTGTTGGCACAGACAATGGC
CACCGACCCTCAGACGTTCCTCAAACAACAGCAAAAGATGATGCAGTTCCTGCCCCCCGCTCAACGGAAGGCTTATGAAA
ACATGCTAGCCGAGATGGAACAGGCCATGAAGATCAGTTCAAAGTTTTCAACAAACTCACCACACGACGTCAAGGTCAAC
AAGTGGCTTTCAGACATGACAAGTCCACTGGGTGACCAGCTGAGCATTGATTACGTAGGAGGAGGCGGGGCAAGTGGTTC
GGGAAGTGGCAATAGTCGGCGCTCGAACCGCCAGCAGGGAAACTCACAACAATCCTCAAGTGCAGCCCAATTGCAAAAGC
AACAGCAACAACAGCAGCAGCAGCAGCAACAACAACAGCAACACTCGATGCCCGGGCCACAGAATTTGACAGGAGAGGAG
CCCGTACCAGTGATCAATAAACAGACAGGCAAACGCTTGGGAGGCAATAAAGCGCCGCAGCTAAAGAGACTTATGCAATG
GCTTACGGAGAACCCCAATTACGAAGTGGATCCAAAGTGGCTGGAGCAGATGCAAAATCCCATGTCAACACCGTCACCAA
GGCCCGCATCAATGGAGAGCGGCTACGGCTCCTCGGCAGTGAAATCACATGGTGGTCGTCCATTATCTAATTTGAGTAGC
ACCTCATCATCGTCCCACACCCAACAGCAATCATCTGCAGCTCAATCGCAAGCGGGAGGGAACTCAGGCAGCTCAAAGAA
AAATTCCCGCCAACAAACTGCGGCATCAGCTGCACTGGATCAAGCTGCCTTACAATTTGGCTCCTTAGCGGGTCTGAATC
CCAGTCTGTTAGCAAATCTTCCTGGACTGGGCGCATTTGATCCCAAGAATCCTCTTGCTGCATTTGATCCCAAAAATCCG
TTGCTATCCATGTCTTTTGGAGGAATGCCCGGAATGGGTAATATTCCTGGACTAGGTAACCTGAACAACATGAACCTATT
TGCCAGTTTGGCAGGAATGGGAGGATTGGGTAATCTTGCAGGGATGGACACTCAGTCGCTGGCTGCGCTCATGGCTGCTG
CCGGGCCAACTCTTGGCGGATTAACTGGTGCATCCGGAGGAGCGGGCTCCGGCAAGAGCCAGGCGCAGTCGCAATCATCC
GCCACTTCGTCATCCTCTTCGGCTAGTAAAAAGAAGCAGCAGCAACAGCAACAACAGGCACAAAATGAAGCTGCTCAATT
GGCAGCTGCTATCAGCGCAAGCACTGGAGGATCTGGCGCATCAGGGGGAAAGAACGCAGCTGCTTCTGCATCACAATTGG
CGGCCGGATTTCCATTCCTATTTCCGAATCCATCATTGCTGTATCCGCCCATGGGACTAGGTGGCCTGAATCCGTATTCC
CTTGGATCTAGTGGACTTGGTTCCGCATACGATCAGTTGGCTCAGCAGTATAACCTGCTAAATGGAGCTACTTCATCGGC
CTCAAATACGAGCTCCACGCAGTCTAAGTCGCATCAGTCGCAATCAAAATCCAGTCAGTCCAGGAATACCACAGCATCTG
CCAACTCAGCAGCAAGTCTGATGAATGCTATGGCCAGCATGGGCGGTGGCGCTAGCACAGTTACCACGCCTTCAACTTCA
GCATCAGGATCCGGACGTGGCAGGCAATCAAGCAGCAGAAATCAGTCCCAAACCACACCCACAGCAGCAGACATGGCTCA
ACTCAGTAGTCTACTTATGCCAGGAGCGGATCCGCATCTTCTCGAGTCCTTGAGCCGTATGAGCAACATGGATTTGGCGC
AGGCAACACGTCTGATGAGCTCCCTGGGAATGCCGCCTCTTTCAGGAACGCCGAGCTCTTCTGGTGGAGGTAACACATCT
ACAAGCAAGAGAAGCAGCCAAGCCGCAAATGAAGCTAACGTTCAGGCCAAGGAACAGCAAAAGTGGTTAGAAAGTTTAGC
CCGAGGAGCTCTGCCAACTGATTTAGCCGCGCTTCAAGCTTTCTCGCAAGGCAAAATGCCATCAACATCCGGATCAAATA
CGGGAACATCCACTTCCTCTAGTAAGAGCTCGAAAGCAGCTGCGACAGCAGCGGCAGCTCAATTACCACAAATTCCTGGC
ATGTCCAGCGATTTCCCACAGGCCTTTTTAGCTGAAATGGCTGCACAGGCAATGGCGGCTGCGGGGGGATCCCTTCCTCT
TAGTGGTCCAGGTTCATTAGCTAGTTTGGCTGGCTTAACTGGTGGCTCTGCTGGAGGTGGTGGTTCTTCTGCCTCAGGAA
GCACTAGCCACTCTTCTTCGAAACGGCAGCGTGAACAGGATGCCTTTAAGCAACAGATGGACTATTATACCAAGACCTTA
GGTCTGGGATCAGGAATCTCGTTGATACCCACATCCTCGGCGGGAGGATCATCTGCATCCTCTAGTGCAGCAAACGCAGC
AGCAGCTGCGTATGCTGCAGCTTTGGACGCAGAGCAACAGCATCAACAACAGCAGAAGGCGCTATCCAAACGAGCACGTG
GGGATTTACACCCCACAAAGGAGGAATTGGCCGCCCTTGCGGCAGGCTTACCCCTTAATCTTGGTGCCAGCATGAGTAGC
ATAGAAAAGAGTCTAAGAGGCGGAAGCAGTTCCAGTAGCAGCTCTACACCAGCGCCCATGACTGCGGAACAGGATAAAGT
TACATTGACTCCCCTTAATGCCTCTGGAGGCGGATCGGGGTCCTCTTCCAGTTCAGCAGCTGCTGCGGGACTGGCAGCTA
ATCTGCCCAGTCAAACTACAATAACCATAGCTCCTCCCATTAGCAGTGGAGCCAGCACTAGCAGCGAGCGTTCCGAACGC
TCCGAGTCGCGCATTTCGCTAACCATAACAAATGCAGCGGATGCCGCGAAACTACCGCCGCCCTACGAAGAAGCCGATGA
GCTAATTATACAGCCCATACTCAAAAAGCCTACCGCTGCCAATCCAGGCAGTAGTCATGGCGGAAGCGTGGACGATCTGG
ATACAGCTGAAAATACTTCAGCTGCTAATCTGAGTGGCTCATCCTCCAGTTCTGCAGCTGCTGCGGCTGCAGCGGCGGCT
GAAGAGAATCGACGTTCCTCCAATCGCTTGAAGCGTCCGAGGTCTGGTAACGAACAAGGATCTGGTTCCGTGGAAGGACA
ACCGCCTGAGAAGCGACGGGAGTTGCGATCCACTCGTCATACACGCTCTTCGGCAGATGCCAGTACGCTTAATCTTTCAA
CTGGAAGCGAATCGGGAGCGGAGGAACGGAACGAATGAGTATTGCGCAGATCCGAGCGCCAGCGCTAGCAGAATGACACG
GCCCATACTAAGGGCCGGAGAAAATCGCGTAGAGGAGAAGCCAATCCGGCCAATACATGCAAGTCACCGGAGCAGAAAAT
CAACAACAGAAAGATGATGAGAAACCAGCTGCAGATGCGGATGCAAACGAGATCGAGGCGAAATTTAAATGCTAGGTTAA
CTGTTACCACTAGATCCCTTAAGCTTAAAGTTGTGTAAAGTATAAGAACCATATATAATCTATATATAGAGATTAGGAGC
CAATTTGGAGAAAACGGATTTGGGTTTGTCTCAACGCCATAAAGTTCGACACTGCTGCAACTCCGTCTGAACTGGAGGGC
AGAGCGCCTTACCCATGACTTACTCAAGTTTCATCTGCTGCTTATATGGTGCTTGATAAGTCAATAGTGTCCCTTCCTCT
GGCTGCTTAATTATTTATATAATTACGAACATAATTAAAAAGCGCTTATAATTTAATTGTAACAAGAGAAACAAAGTGCT
GTTGCACGACGAGGATTTTCCGTTTAAATTATTGCTAAAACGTATAATTGATAAGCGACAGAAAAATGTTTAAACAAAAC
ACTATCCATGCATAAAATGTAGAGACACATATACTTGGGTTTCTGGCGCTGTCCTGGCACATGCAGTCTCTATACATATA
TAATACCTGTACATAATTCATAATCTTAAAATGACTCGTATTGCTTAACTGTTTTTAATATAGTAAGGCACCATGTATTC
TCCTCAAACTAAACCATTTTCCACACTTCCATCCCCAATATGTTGTATACTGAACTCTCTATTCTTTATGTGTGTCCCCG
AAAGCTGCGTGTAATTTTGATCATTTTAATTCTGTAATTAGTAAATGTGAAAGGATGGAATGCTAATGGCGCAAATCAAT
CTTTCAAGCGTATATTTTAAACTCTTGTATTTGTAATTCGTATGTTTTATTATACACTTGTGTGTCCCATGAACCACCGA
CACCAACATGCAAGTCCTGGCGCGTAACTAACAGGTGGGAAGTGTTTATTGAAAAATAGAATTTTTTAATTAAATCAATT
TTGTTGTAATTGAGAAGCCCGAGAATATGAATCTTGCACGCTTGATGAGCAGCAATGCAATATTTAGGTCATTTTGTATA
ATTATTCAGCTGAGTAAATGAATTATGGACAAATTTGATCCGCACTTTATGAGAACAATTTATTTTGAGACGTTAACAAG
GCACACAAAAAAAAAGCAAAACAAACAACCACATATATTGCATACTTAATTTGTAAGTATTACTCGTAATTAAAATTATT
ATATAACTGCAGAACAACAAACAAAAGCAACATCAACCAGAAGAAGCAACAACAGCAAGAAACACCCAAGCATCAACTAT
TGATATTGATGATAAATAAATATATAAAAAATAAATTTTAAAAATTAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0078144
17943
FBtr0078145
8225
FBtr0308253
18006
FBtr0308254
17733
FBtr0308255
17731
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289115
5517
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0077803
5322
FBpp0077804
2151
FBpp0300573
5343
FBpp0300574
5252
FBpp0300575
5191
Comments
Merge of internal exons supported by FBrf0201797.
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
kis-RC
Secondary FlyBase IDs
    References (0)