Open Close
General Information
Symbol
Dmel\Jabba-RC
Species
D. melanogaster
Annotation Symbol
CG42351-RC
FlyBase ID
FBtr0299943
Feature type
Associated gene
Evidence Rank
Length (nt)
2029
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 20 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACCACTGATCAGTCAGTCGGGAGTTGTGCAGCCGGTAGATCGTTTCTCCAGGATTTCAAGGCAGATTTGGAAGAAAGTTC
        TGCCAAAGTGTTTTTTATTATATCCAAAAATCTTCTAGTAACTGCATTTTTTGGGCAAACTATCGGCTGGTACGAGAGTT
        TAAAAGAAGGCCTATAGAATTGCACAAAATAGCGTGAGAAAGGCAATCGAAAAGACCGAATCAGCAAGATGGCACAGGAG
        ACGAAGACCGTGGCGACAGCCAAAGACCAGAACCAACGAGACCATATCGACGAGGAAGAAGTCATCGAACTCCACGAGTC
        ACGCAGCTTTTACGATCGGGTTCGCGAACAGGCGGAGCGATTTGCTAGCACACGAGTTGGCCAATTCGTGATCGAACGGG
        CTGATAAAGCGCTGGCCATGATCGAGGATACTGCCAAGTGGAGTCTTCCGCAAGACAAGTCTTCTGCTCCCTTGGAACGC
        CCCCTGCCTTGGGCTCCATTCCTGATGCTCATCGTCCTGCTGCGGCTCACACGCATTTGGTTATCGGTTGGCGCCCTGAT
        GATCGGCAATGGTCCAATATCTCCTACGGATATGGTATACTTTATACAGACTAGACGCCGCAAGCTGCGGGCCATTCGGG
        TTCATGGCCTAAAGGTGATGAGACGGCGCCAGCAGGAGGTGTCCTATGGCAGTGGCAAGGGTATGACCCAGAAGCTCAAT
        CAGTGGTTTTCCCGAGCCATGTGCCGTCCAGGAGTTCAGCAGGATAGCAGCAGTCGCCGGGTGTTTGTCCGCCATTCGGA
        GCAGGGTTTAAGCAATTTCGTAGTTAAGCGCCCTCGAGAGGAGGACTGCAATGCCGATGCCGACCTGACCATCGACCAAA
        TGCTGGCCAAGTATGCCAACGAGAATTCCGAAGATGACTCCGACTTTGTGCCCAATGAGGAGGAGGAGGAGGAGGAAAGC
        AGCAGCAGCAGCGGGGAAAGCGAATCCGAATCCGGCTCCAGCGAAGGAATAAGCAGCGGCGAGGTGGATGAGGTTGTCAG
        CCAGCCCAAGCAGAAGTCAGCTGGAGCGGTGGTGGAAAACGGAGTGCACAAGGCCGAGGAGAAGGAAAATGATAAGGGAA
        AACTGAACATAACGACAACCAGCAATGGCAACAACGACAAGGAGCAGGCGGATGTTGATCATCCATTCATTTGCAGGCCC
        GAAAACGAAAAATTCAAAATTAGCCACCAAGCCACTTCCGCTGCCCAGCCGGATGAGGAGTGGAAATCTTCGCCAGGACA
        CATGAGCGCAGCCGTGATGAATACCCGACTGTACAACAATACTGCCGCTGCAGTCACCACTGATCCTGATCCAGAACCTG
        ACACTCAGCCTGAACCCGAATTCCCATCCGAACCTACATCCCAGTCCCAACCCTCAACCGAAGAAACAGATGACGATGCA
        GAGGATAGTTGCAGCTCCAGTGGCAGTAATCAAACCGGGATAACTGTCTACCAGGCCGATGAAACCCAGCCAGATACCCA
        AGCTGAACAGATCCTTGAGATTGCCGCCACGTTAACTGATTCACATCTATCCAACTATCCCACTGTTGACACCCTAACTC
        CTGCCACCTCCTCCGAAGACATATTCTATAGCCCTATTGGTTCACCCACTTGCTTCAATACTAGCCTAGGAACCCAGGCT
        CTCCTCAAGAGGGCCAGCATTCAATCCGTCCTGGCCCACTCCACGCCCACGACGGAGATGAGGGATCAACCCATTGAAGA
        GGCAAACAACTCGGTGCCCCAAACACCTGAGACCGAGAAAACTCAGCCCCAAACTCCCAAGGAAGTCCATAATCAGAATC
        AGCAGCAAAATCAACAGCAGCGCCAACGCAATCATCCCCACCAACGTTATCGTGGACGCAATCGGCGCTAGTCCTTGGAA
        GGATATCCTTGTCATATCGTTTGAATTTCCTCCTAGCCAGCTAGCCGTTCTTCTATTTTTTTTACATTCCCATATTGTTA
        GTGAATACTGCGAGTAAATCTCTGAACTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0299942
        1323
        FBtr0299944
        1622
        FBtr0299945
        1628
        FBtr0304051
        1925
        FBtr0304052
        1663
        FBtr0330006
        1667
        FBtr0333163
        1567
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289220
        560
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0289219
        320
        FBpp0289221
        367
        FBpp0289222
        438
        FBpp0293014
        537
        FBpp0293015
        438
        FBpp0303041
        388
        FBpp0305366
        406
        Comments

        GC splice donor site postulated.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG42351-RC
        Jabba-RC
        Secondary FlyBase IDs
        • FBtr0100075
        References (0)