Open Close
General Information
Symbol
Dmel\Jabba-RE
Species
D. melanogaster
Annotation Symbol
CG42351-RE
FlyBase ID
FBtr0299945
Feature type
Associated gene
Evidence Rank
Length (nt)
1628
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCCGTTAGTCATTGTCGGCGGAAGGCATTAGAGCTATACGTACATATAGCGACTATAAGTTTTGCCAGACGGCAGCAACA
          AAAAACAAAAGCAATCCTCCATCCGAAACTCAAACAAGTGCGAAGTACCGATCCGCTCCGATAAGCGATCCACTTTCGGT
          TCCTCTGGCAGACGACCTCGGATCGTCAGCAAGATGGCACAGGAGACGAAGACCGTGGCGACAGCCAAAGACCAGAACCA
          ACGAGACCATATCGACGAGGAAGAAGTCATCGAACTCCACGAGTCACGCAGCTTTTACGATCGGGTTCGCGAACAGGCGG
          AGCGATTTGCTAGCACACGAGTTGGCCAATTCGTGATCGAACGGGCTGATAAAGCGCTGGCCATGATCGAGGATACTGCC
          AAGTGGAGTCTTCCGCAAGACAAGTCTTCTGCTCCCTTGGAACGCCCCCTGCCTTGGGCTCCATTCCTGATGCTCATCGT
          CCTGCTGCGGCTCACACGCATTTGGTTATCGGTTGGCGCCCTGATGATCGGCAATGGTCCAATATCTCCTACGGATATGG
          TATACTTTATACAGACTAGACGCCGCAAGCTGCGGGCCATTCGGGTTCATGGCCTAAAGGTGATGAGACGGCGCCAGCAG
          GAGGTGTCCTATGGCAGTGGCAAGGGTATGACCCAGAAGCTCAATCAGTGGTTTTCCCGAGCCATGTGCCGTCCAGGAGT
          TCAGCAGGATAGCAGCAGTCGCCGGGTGTTTGTCCGCCATTCGGAGCAGGGTTTAAGCAATTTCGTAGTTAAGCGCCCTC
          GAGAGGAGGACTGCAATGCCGATGCCGACCTGACCATCGACCAAATGCTGGCCAAGTATGCCAACGAGAATTCCGAAGAT
          GACTCCGACTTTGTGCCCAATGAGGAGGAGGAGGAGGAGGAAAGCAGCAGCAGCAGCGGGGAAAGCGAATCCGAATCCGG
          CTCCAGCGAAGGAATAAGCAGCGGCGAGGTGGATGAGGTTGTCAGCCAGCCCAAGCAGAAGTCAGCTGGAGCGGTGGTGG
          AAAACGGAGTGCACAAGGCCGAGGAGAAGGAAAATGATAAGGGAAAACTGAACATAACGACAACCAGCAATGGCAACAAC
          GACAAGGAGCAGGCGGATGTTGCCGCTGCCCAGCCGGATGAGGAGTGGAAATCTTCGCCAGGACACATGAGCGCAGCCGT
          GATGAATACCCGACTGTACAACAATACTGCCGCTGCAGGTTCACCCACTTGCTTCAATACTAGCCTAGGAACCCAGGCTC
          TCCTCAAGAGGGCCAGCATTCAATCCGTCCTGGCCCACTCCACGCCCACGACGGAGATGAGGGATCAACCCATTGAAGAG
          GCAAACAACTCGGTGCCCCAAACACCTGAGACCGAGAAAACTCAGCCCCAAACTCCCAAGGAAGTCCATAATCAGAATCA
          GCAGCAAAATCAACAGCAGCGCCAACGCAATCATCCCCACCAACGTTATCGTGGACGCAATCGGCGCTAGTCCTTGGAAG
          GATATCCTTGTCATATCGTTTGAATTTCCTCCTAGCCAGCTAGCCGTTCTTCTATTTTTTTTACATTCCCATATTGTTAG
          TGAATACTGCGAGTAAATCTCTGAACTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0299942
          1323
          FBtr0299943
          2029
          FBtr0299944
          1622
          FBtr0304051
          1925
          FBtr0304052
          1663
          FBtr0330006
          1667
          FBtr0333163
          1567
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0289222
          438
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289219
          320
          FBpp0289220
          560
          FBpp0289221
          367
          FBpp0293014
          537
          FBpp0293015
          438
          FBpp0303041
          388
          FBpp0305366
          406
          Comments

          5' UTR based on RNA-Seq data.

          GC splice donor site postulated.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG42351-RE
          Jabba-RE
          Secondary FlyBase IDs
            References (0)