Open Close
General Information
Symbol
Dmel\CG4678-RF
Species
D. melanogaster
Annotation Symbol
CG4678-RF
FlyBase ID
FBtr0300034
Feature type
Associated gene
Evidence Rank
Length (nt)
1875
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCAGTCGAACTTAAACGGCGCTGGCAATCGGACGCGTTTTCGAAAACTCGCTCTCTCTGCGATTTCATTCTGGTTTTTTG
        GGAAAGTAAAAAAAGGTGCGAAGAACAACGAGAACAACAACAACAACAACAACATCAACGGCAGCTGCAAGAATAATAAT
        AGAAATTGCTGTCGAGCAGAAAACTGGAAATCCAAAGGCAGCAGCAAGAAATCAGTTTTGACCATTCGCAGACTCACCGC
        CGACCGACCATGATCTTGCGAACGCCACTCGTTGCCGGCCACCAGCTGCAGCTGCTCCTGCTGCCCTCCGTCCTGCTCCT
        CATGCTCCATCTTCTTCTCTGCGATGCAAAGACGGTCAATCCCGGTGATTCCATGCAGATGCAGCATCACCAGATGACCG
        CGGAGCCGGGACTGCCGGAACCCAGGGCCTACATGCCGGATGCCCAGCATCTGGACTTTGTCTACCACGATCACGAGGAG
        CTCACAAGATTCCTTAGAGCCACCAGTGCGAGGTACCCCAATCTCACTGCCTTGTACTCCATCGGAAAATCCATCCAGGG
        ACGTGATCTTTGGGTAATGGTGGTCAGCTCGTCGCCATATGAGCACATGGTGGGTAAGCCGGATGTGAAGTACGTGGGCA
        ATATCCACGGAAACGAGCCAGTCGGCCGGGAGATGCTGCTCCACCTCATCCAGTATTTCGTGACCAGCTACAACACGGAT
        CAGTACGTCAAATGGCTGCTGGACAACACACGGATTCACATTCTGCCCACAATGAATCCGGATGGTTATGCGGTTTCCAA
        GGAGGGCACATGCGATGGTGGCCAAGGAAGATATAATGCCCGTGGATTCGATCTGAATCGCAACTTTCCCGACTATTTCA
        AGCAGAACAACAAACGGGGTCAGCCAGAAACGGATTCGGTAAAGGATTGGATATCCAAGATTCAGTTCGTGCTCAGTGGA
        AGCCTGCATGGTGGTGCCCTGGTGGCCAGTTATCCGTACGACAATACGCCGAACTCCAGTCCTTTGGGCGCAGTGTTCCA
        GACCTACTCGGCGGCGCCATCGCTGACGCCCGACGATGATGTGTTCAAGCACCTGTCCCTGGTCTATGCCCGCAACCATG
        CCAAGATGTCCAGGGGCGTCGCCTGCAAGTCAGCGACGCCGGCCTTCGAGAACGGCATCACCAACGGAGCCGCCTGGTAT
        CCACTGACCGGCGGAATGCAGGACTACAACTATGTGTGGTACGGCTGCATGGAGATTACGCTGGAGATATCCTGCTGCAA
        GTTTCCGCCAGCCTACGAGCTCAAGAAGTACTGGGAGGACAATCAGCTGTCACTTATCAAATTCCTGGCCGAGGCGCATC
        GCGGTGTCCAGGGATTCGTGTTCGATCCGGCGGGCATGCCCATTGAGCGAGCCTCCATCAAGATCAAGGGACGCGATGTG
        GGTTTCCAGACCACCAAGTACGGCGAGTTCTGGCGCATACTTCTGCCGGGCTACTACAAAGTGGAGGTCTTTGCCGAGGG
        CTTCGCTCCTCGCGAGGTGGAGTTCGTGATCGTGGAGCAGCATCCCACGCTGCTCAATGTAACGCTGCAGCCCTCAAAGT
        ATCTGGTGGCTACGGGCACATCCACCACCACAAAATCCTCAACGGTGAATCGCCGCGTCAATGGAAAGCTGCAGCTGTCA
        CCAGAATAATGGCGATCCGATTTCTTTGAGTGTGTAAATAATAGCTAAATTGGTTTAGACCTAGAAAATGATACGCAACT
        AACCCACTAAAACACCATTGAAGTAATCTGTTTTGGTTTTTGCTTTAGTTCCCATTGCGATTAAGTTTATGAAACAAAAT
        AACGTTAACTTTCCAAATTATTATAGTTTAAACAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0300032
        2007
        FBtr0300033
        1994
        FBtr0300035
        1902
        FBtr0308847
        1952
        FBtr0339827
        1982
        FBtr0339828
        1670
        FBtr0339829
        2062
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289311
        479
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0289309
        518
        FBpp0289310
        527
        FBpp0289312
        488
        FBpp0301002
        513
        FBpp0308861
        523
        FBpp0308862
        404
        FBpp0308863
        474
        Comments

        Unconventional splice site postulated (GT-AT).

        transcript_exception: non_canonical_splice_site

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG4678-RF
        Secondary FlyBase IDs
          References (0)