Open Close
General Information
Symbol
Dmel\wech-RA
Species
D. melanogaster
Annotation Symbol
CG42396-RA
FlyBase ID
FBtr0300080
Feature type
Associated gene
Evidence Rank
Length (nt)
4495
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 80 )
Sequence
GAACGTGAGTTTTGCAGTTTGATGGTTAAATGCGTGCGTGAAGGTTGGAGTGAAGATTTTGAGCCGAATTCGAATCCTAG
TCCCCGCCGCAATAAGTGGGTCAGAATTGGAGCCGTTCGATTGGGCCAAACAAAAAGCTGGGCGCCACCGCAGACTGCAG
CTAAAACACGCCGCCAAAAAGGAAAAGTGCACGAGGGTGGAACCAAGGGTAAATAAGATTCGCCCGAAAACGCTTGGAAA
ATGTAAACAATCTGTAAGCACAGCGACGATAAGCGATTTTCAAAGAGTTTGCCAGCTTTTTACATCGATCAAACACTCGC
ATAATAAACGAATAAGAACTGACGATTAAATCGAATTGAAGTGGAGTGACGACTATGGGATACCCTAGGACCGCGTAGAG
TGAATGAATTTGACAACGGAAAAGCGCCACTCCATTGACTGCTGCCTTGTGCTATAGAAACGTGATCTCACCACTCTTAT
GATGGAACTTTTGTCAAACAATTCGGTTCCGCAACAAATGGCCAGCAGCAATGCGCCGAGCGCCAACAATGTGGCCCACT
CCTCAACGGCCAACGGAAGTGGAGGCGGCAGTGTGAGCAGCAATGCCAGCAACTCCTCCGAGCGACTGCTGGCGGGCATC
CTGGAGAGCTTTCCCGCCTGGGACCTCAACGTGGGACTACTGCCCAACGTGGGCCAGAGCTCACCACCACGCGCAGACTT
CTTTATCAATAACTTCCTGGGCGGCCTGGACACGCATGGCGACTTCAGCATTGGACCCATTGGCAGCGGTGCCCGCAGCA
ATCCGAAGATGTCGCCAGAGTCATCTAACAACTCGAGCATCAGCTGCGGTTGGTGCGAGGTTAGTGCTTCAATACGCTGC
CTGGAGTGCAACGAGTTCATGTGCAACGACTGCCTAAGGGAGCATCGCAACAGTCCGCTGTCCTCCAACCACTCGATCGT
GTCCTTGCCCACGCCCATTGGAGCCTCGCCCACGGGTGGCAGCTCGGTAAATGCACAGACTCCGCCCAGCGGCAACTTTA
TCTGCGACATACACAACGAGATGTTGCGCTACGTATGTGACTACTGCCGGAAATTGGTGTGTCAGTGCTGCACACTGCAC
GAGCACAAGGAGCACAGCTACGCGTCCATCCAAAGCTTTATGGTGGGCTCGAAGGAGAAGCTGGAGGGCGCCATTGAGAG
CAGCCAGGTGGGCACGCGCTGCATTAAGAGCAGCATTGACAAAGCGTTGGCCTTCATCCGGCTTATCGAGCGCAATTGCA
GCGAGCTGAGCGATAATATACGCAAGGCATTCCGTCAGTTTATCATTGCCATCGAGGACCGCGAGCGTTTCCTCCTGGAC
TTTGTGGAAAAGCTCCGCCAGCGTCGTCTGGCCATCCTACACGATCAGATGGCAGGCTTAAAGTCTGCTCTCGCCGGACT
CTCCGAAACGTCCGATATGCTTAGCAAGGTGGCGGACAATGCCTGCAACATGGACCAGATTGAAATTGCCATGAAGTTGA
CCAATGGGCAGAGGCAGATGGAGCAGTTTGCGGGCATATATAAGGACCTGCAGCCAAAACAGGAAGTCTTTGCCTTCGCA
CCACCAGATTACAGCCTGCTACAGGATATCCGCAACCAGGGTGGCGTTATCCTGGTGGACGACAAGAACTTGCCCATCGT
CTCTAGCAGCAACGGAATTGTGCCGAGCGTCTCCAGTGTTAATGCCGTGGCCGCGGCCTCCGTGGGAGTTGTGGGAGGCG
TTGCTGGAGTAGTCGGAGGCGTTGGCGTGTCAAACGGCCTGGACTTGGCCTTCGGCATGAACATGCCCAACAATCCGCTG
AGTGTTGCTTCCTCAAGTGTGCGACGTCCCCTGTTGCGAGACAATAGCTTCCGGATTCCATCGCCCATAATGCAACCACG
CGGAGGAAGTGCCTGTGGGATGTCCAGTGGGATGTCCAGCGCTGCTCTTGATTGGGAACTCAATGGACTGCGCAGCTCGC
CAGGATTACACTTCAGTGCGCCGCGAACCACGCAGGCCATTCCGGGATGCATGGATCTGGTCAAGGTGCGTAACTCGAAT
GCTCTCTCGCTATCCTTCGCCACCGAGGGCCACGAGGACGGACAGGTGAGCCGGCCATGGGGTCTATGCGTTGATAAAAT
GGGCCACGTTCTCGTATCGGATCGCCGCAACAATCGCGTCCAGGTCTTCAATCCCGATGGCTCCCTAAAGTTCAAATTCG
GCCGTAAAGGCGTGGGCAATGGAGAGTTCGATCTGCCTGCTGGAATCTGTGTTGACGTTGATAATCGCATTATTGTGGTC
GACAAGGACAATCACCGTGTGCAAATCTTTACCGCCAGCGGCGTCTTCCTGCTCAAGTTCGGCAGCTACGGCAAGGAGTA
CGGCCAGTTCCAGTATCCGTGGGATGTGGCCGTGAACTCGCGCCGCCAAATTGTGGTTACCGACTCGCGCAATCATCGCA
TCCAGCAGTTCGACTCTGAGGGTCGCTTCATCCGCCAGATAGTGTTCGACAACCATGGGCAAACCAAAGGAATCGCCTCG
CCACGAGGCGTTTGCTACACGCCGACGGGCAACATCATAGTGTCTGACTTTGACAACCACTGCCTCTACCTGATTGATCC
AGACATCAACGACATTCTTTCCGTGAAGGGACATGAGGGCTCGGGCTTCCATGAATTTAATCGACCCTCCGGCCTGTGCT
GTGACGACGAGGGCCGCATTATAGTGGCCGATTCAAAGAATCAACGCATCCTGGTCTTCAATCAGAACCTGGACTTTATG
TGGGATATCGAGGTGCGACCCTCCATCAATCCCTTGATGCCGCCCACGCTGGACGAGAAAGATCGCACTTGCGATGTGGC
CATAATGCCAGACGGTCGCATTGTGTTCCTCATTGAACTGTCGCCAGACTCCAAGGAAGGGTCAAACCCTTACAAGCGGT
TTGTGCACGTATTCTAAATAAGGCCACGAGTGCCGATCTTTTTTTTTAGACCATTTACAAGAGCGAAACCTTAGCGTAGA
GTTTCAAATAACATGACGATTATGAGGAGGTGCCGAAACCGATTTAATAAGAAAAAATCTGAAATCATGAAAGTTAGCGA
AAATTTTTAGCTTAAGTGCTACAACGATTACCTCGATATTGCTTAAGAGTTATGGTTACGATTTGGTAATTTACAATACA
ATACGAATTACACATATGTATCTATGGATATCTATATCTATACGCATATGCATATATCTAGCGAATATACAAGCCCAACC
AACTAGAACTATAACTAAAACAAAAACAAAAAACAAAAACTAAAGCGAAAGGCAGGCGGTTGAGTAGGATTTAGGAGATA
TATATAAACGTAGGGTCCGTGAGCATTCAGTAGAGTTACCGAACCTAGTAAAAGATAATGCAAAGAGGGAACTCAACCAT
TTACTAGATGAAAATATTATTACCTGTTAGTTAGACTGAAAGGCAGTTTGCTAGCTGATAGAAGGAGGTACGAACCAGGT
CAGGTGGCGATTGTGTTTTTTTTTACGGGTTTGCTTAGCGGAATGAGGAAACTACATTCGACAAGAGTTACTAAACATGA
TTTGCAGAAACACTGTATGGTATGGTATTAATGTTTGTATTATATTTATAGTTCGTTTGTTCAGTTCTGTTTTTCGTTTA
TTTTAAAATTACTTTTTTTTTGGGACATACATATGTATTTTAATGATTTCCTTATAATTGAGACTGAGCATTTGACAACA
CGAACTTTGCGTGTACGGAAGCAAAGCGAAACAAAACAAAGAAACAAACAAAAAACAAGAAAATATTGATGGAACCCGCT
GACTTTTCGTTGAACTTTATACAAAGACTGATTAACTAAACCGCAATTTCGGAGCCAACTAAAGAACCATATATGGTGAG
GCCAAAATAAGTGAAAGAGCAACACACTCAAATTGCAATGACATTGATAACGTAAAGTAACTTAACATAGCTTAACATAC
ATACTTTCGCGCATATAGAGCGATACAGATATCATATAGATCCGATCATCCAGTCACGAATCATCATGGGCATAGCTGAA
ACCGAGTTTAACTGACATTCATCGACATATTTACCCATCCATCCATCCATCCATCCACTCACTCATACCGATCATGCATC
ACAGGGCTTTGTTTTTCGTTTGTCGTTACTTTGTAATTATTGTGAAAGGATTTAGCCACAGGATACAGATTCACGGCAGG
TTGAAAGGAGGAGGAGGAGGAGGGAGGGGTTAGCTAAAATTAGTGGGACATTTTGGGAAGTAAACGAAACAGACCTGAAA
CAAAATAACGAAGAAGTTATAATTTTTGACTCAATGTGTTCATTAGCATTTAGTAGACTTAGCGGGCGTGGCATAGTGAA
AACGTATGGAAAATCCAGAGCAATATAAGGGCGTATTGAATACACATTTAGGTGACATGTTCCTCGCAAAAGAAACAAAT
AAAACAAAACAAAAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0300081
3290
FBtr0300082
7593
FBtr0300083
6021
FBtr0300084
4316
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289357
832
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0289358
832
FBpp0289359
832
FBpp0289360
832
FBpp0289361
832
Comments

Transcriptional initiation site supported by CAGE and/or 5' RACE data (FBrf0213090).

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG42396-RA
wech-RA
Secondary FlyBase IDs
    References (0)