Open Close
General Information
Symbol
Dmel\wech-RB
Species
D. melanogaster
Annotation Symbol
CG42396-RB
FlyBase ID
FBtr0300081
Feature type
Associated gene
Evidence Rank
Length (nt)
3290
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GAACGTGAGTTTTGCAGTTTGATGGTTAAATGCGTGCGTGAAGGTTGGAGTGAAGATTTTGAGCCGAATTCGAATCCTAG
      TCCCCGCCGCAATAAGTGGGTCAGAATTGGAGCCGTTCGATTGGGCCAAACAAAAAGCTGGGCGCCACCGCAGACTGCAG
      CTAAAACACGCCGCCAAAGTAATTGGAAGAAGAAGCAGGCGCACAATAGGAATAATTGTTCATGGATTTTTTCGATTTCT
      CGTTCGCTTGCAGAAGGAAAAGTGCACGAGGGTGGAACCAAGGGTAAATAAGATTCGCCCGAAAACGCTTGGAAAATGTA
      AACAATCTGTAAGCACAGCGACGATAAGCGATTTTCAAAGAGTTTGCCAGCTTTTTACATCGATCAAACACTCGCATAAT
      AAACGAATAAGAACTGACGATTAAATCGAATTGAAGTGGAGTGACGACTATGGGATACCCTAGGACCGCGTAGAGTGAAT
      GAATTTGACAACGGAAAAGCGCCACTCCATTGACTGCTGCCTTGTGCTATAGAAACGTGATCTCACCACTCTTATGATGG
      AACTTTTGTCAAACAATTCGGTTCCGCAACAAATGGCCAGCAGCAATGCGCCGAGCGCCAACAATGTGGCCCACTCCTCA
      ACGGCCAACGGAAGTGGAGGCGGCAGTGTGAGCAGCAATGCCAGCAACTCCTCCGAGCGACTGCTGGCGGGCATCCTGGA
      GAGCTTTCCCGCCTGGGACCTCAACGTGGGACTACTGCCCAACGTGGGCCAGAGCTCACCACCACGCGCAGACTTCTTTA
      TCAATAACTTCCTGGGCGGCCTGGACACGCATGGCGACTTCAGCATTGGACCCATTGGCAGCGGTGCCCGCAGCAATCCG
      AAGATGTCGCCAGAGTCATCTAACAACTCGAGCATCAGCTGCGGTTGGTGCGAGGTTAGTGCTTCAATACGCTGCCTGGA
      GTGCAACGAGTTCATGTGCAACGACTGCCTAAGGGAGCATCGCAACAGTCCGCTGTCCTCCAACCACTCGATCGTGTCCT
      TGCCCACGCCCATTGGAGCCTCGCCCACGGGTGGCAGCTCGGTAAATGCACAGACTCCGCCCAGCGGCAACTTTATCTGC
      GACATACACAACGAGATGTTGCGCTACGTATGTGACTACTGCCGGAAATTGGTGTGTCAGTGCTGCACACTGCACGAGCA
      CAAGGAGCACAGCTACGCGTCCATCCAAAGCTTTATGGTGGGCTCGAAGGAGAAGCTGGAGGGCGCCATTGAGAGCAGCC
      AGGTGGGCACGCGCTGCATTAAGAGCAGCATTGACAAAGCGTTGGCCTTCATCCGGCTTATCGAGCGCAATTGCAGCGAG
      CTGAGCGATAATATACGCAAGGCATTCCGTCAGTTTATCATTGCCATCGAGGACCGCGAGCGTTTCCTCCTGGACTTTGT
      GGAAAAGCTCCGCCAGCGTCGTCTGGCCATCCTACACGATCAGATGGCAGGCTTAAAGTCTGCTCTCGCCGGACTCTCCG
      AAACGTCCGATATGCTTAGCAAGGTGGCGGACAATGCCTGCAACATGGACCAGATTGAAATTGCCATGAAGTTGACCAAT
      GGGCAGAGGCAGATGGAGCAGTTTGCGGGCATATATAAGGACCTGCAGCCAAAACAGGAAGTCTTTGCCTTCGCACCACC
      AGATTACAGCCTGCTACAGGATATCCGCAACCAGGGTGGCGTTATCCTGGTGGACGACAAGAACTTGCCCATCGTCTCTA
      GCAGCAACGGAATTGTGCCGAGCGTCTCCAGTGTTAATGCCGTGGCCGCGGCCTCCGTGGGAGTTGTGGGAGGCGTTGCT
      GGAGTAGTCGGAGGCGTTGGCGTGTCAAACGGCCTGGACTTGGCCTTCGGCATGAACATGCCCAACAATCCGCTGAGTGT
      TGCTTCCTCAAGTGTGCGACGTCCCCTGTTGCGAGACAATAGCTTCCGGATTCCATCGCCCATAATGCAACCACGCGGAG
      GAAGTGCCTGTGGGATGTCCAGTGGGATGTCCAGCGCTGCTCTTGATTGGGAACTCAATGGACTGCGCAGCTCGCCAGGA
      TTACACTTCAGTGCGCCGCGAACCACGCAGGCCATTCCGGGATGCATGGATCTGGTCAAGGTGCGTAACTCGAATGCTCT
      CTCGCTATCCTTCGCCACCGAGGGCCACGAGGACGGACAGGTGAGCCGGCCATGGGGTCTATGCGTTGATAAAATGGGCC
      ACGTTCTCGTATCGGATCGCCGCAACAATCGCGTCCAGGTCTTCAATCCCGATGGCTCCCTAAAGTTCAAATTCGGCCGT
      AAAGGCGTGGGCAATGGAGAGTTCGATCTGCCTGCTGGAATCTGTGTTGACGTTGATAATCGCATTATTGTGGTCGACAA
      GGACAATCACCGTGTGCAAATCTTTACCGCCAGCGGCGTCTTCCTGCTCAAGTTCGGCAGCTACGGCAAGGAGTACGGCC
      AGTTCCAGTATCCGTGGGATGTGGCCGTGAACTCGCGCCGCCAAATTGTGGTTACCGACTCGCGCAATCATCGCATCCAG
      CAGTTCGACTCTGAGGGTCGCTTCATCCGCCAGATAGTGTTCGACAACCATGGGCAAACCAAAGGAATCGCCTCGCCACG
      AGGCGTTTGCTACACGCCGACGGGCAACATCATAGTGTCTGACTTTGACAACCACTGCCTCTACCTGATTGATCCAGACA
      TCAACGACATTCTTTCCGTGAAGGGACATGAGGGCTCGGGCTTCCATGAATTTAATCGACCCTCCGGCCTGTGCTGTGAC
      GACGAGGGCCGCATTATAGTGGCCGATTCAAAGAATCAACGCATCCTGGTCTTCAATCAGAACCTGGACTTTATGTGGGA
      TATCGAGGTGCGACCCTCCATCAATCCCTTGATGCCGCCCACGCTGGACGAGAAAGATCGCACTTGCGATGTGGCCATAA
      TGCCAGACGGTCGCATTGTGTTCCTCATTGAACTGTCGCCAGACTCCAAGGAAGGGTCAAACCCTTACAAGCGGTTTGTG
      CACGTATTCTAAATAAGGCCACGAGTGCCGATCTTTTTTTTTAGACCATTTACAAGAGCGAAACCTTAGCGTAGAGTTTC
      AAATAACATGACGATTATGAGGAGGTGCCGAAACCGATTTAATAAGAAAAAATCTGAAATCATGAAAGTTAGCGAAAATT
      TTTAGCTTAAGTGCTACAACGATTACCTCGATATTGCTTAAGAGTTATGGTTACGATTTGGTAATTTACAATACAATACG
      AATTACACAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0300080
      4495
      FBtr0300082
      7593
      FBtr0300083
      6021
      FBtr0300084
      4316
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0289358
      832
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0289357
      832
      FBpp0289359
      832
      FBpp0289360
      832
      FBpp0289361
      832
      Comments

      Transcriptional initiation site supported by CAGE and/or 5' RACE data (FBrf0213090).

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG42396-RB
      wech-RB
      Secondary FlyBase IDs
        References (0)