Open Close
General Information
Symbol
Dmel\wech-RE
Species
D. melanogaster
Annotation Symbol
CG42396-RE
FlyBase ID
FBtr0300084
Feature type
Associated gene
Evidence Rank
Length (nt)
4316
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCTTCAGTCGGAATAAGGAATACACGATTGTCGGAGCGAACGGATTACGCATAAGAACTCTCTGGAAAACGAATTTCGC
        CTCGCGAAAATCCGCTGAAAAGGCAAAGCCAAGCCAATTCAAAACGGAATCCGCACCGCATCAAATTAAAAATCGAATCA
        ATTAGCGAAAATCGGTACTGAACGCGCGACCCAACAACAACAAAAGCCAAGCGTCTTGCATGCGGCTGCTAAAAAAGCGG
        AAAAGCGCCACTCCATTGACTGCTGCCTTGTGCTATAGAAACGTGATCTCACCACTCTTATGATGGAACTTTTGTCAAAC
        AATTCGGTTCCGCAACAAATGGCCAGCAGCAATGCGCCGAGCGCCAACAATGTGGCCCACTCCTCAACGGCCAACGGAAG
        TGGAGGCGGCAGTGTGAGCAGCAATGCCAGCAACTCCTCCGAGCGACTGCTGGCGGGCATCCTGGAGAGCTTTCCCGCCT
        GGGACCTCAACGTGGGACTACTGCCCAACGTGGGCCAGAGCTCACCACCACGCGCAGACTTCTTTATCAATAACTTCCTG
        GGCGGCCTGGACACGCATGGCGACTTCAGCATTGGACCCATTGGCAGCGGTGCCCGCAGCAATCCGAAGATGTCGCCAGA
        GTCATCTAACAACTCGAGCATCAGCTGCGGTTGGTGCGAGGTTAGTGCTTCAATACGCTGCCTGGAGTGCAACGAGTTCA
        TGTGCAACGACTGCCTAAGGGAGCATCGCAACAGTCCGCTGTCCTCCAACCACTCGATCGTGTCCTTGCCCACGCCCATT
        GGAGCCTCGCCCACGGGTGGCAGCTCGGTAAATGCACAGACTCCGCCCAGCGGCAACTTTATCTGCGACATACACAACGA
        GATGTTGCGCTACGTATGTGACTACTGCCGGAAATTGGTGTGTCAGTGCTGCACACTGCACGAGCACAAGGAGCACAGCT
        ACGCGTCCATCCAAAGCTTTATGGTGGGCTCGAAGGAGAAGCTGGAGGGCGCCATTGAGAGCAGCCAGGTGGGCACGCGC
        TGCATTAAGAGCAGCATTGACAAAGCGTTGGCCTTCATCCGGCTTATCGAGCGCAATTGCAGCGAGCTGAGCGATAATAT
        ACGCAAGGCATTCCGTCAGTTTATCATTGCCATCGAGGACCGCGAGCGTTTCCTCCTGGACTTTGTGGAAAAGCTCCGCC
        AGCGTCGTCTGGCCATCCTACACGATCAGATGGCAGGCTTAAAGTCTGCTCTCGCCGGACTCTCCGAAACGTCCGATATG
        CTTAGCAAGGTGGCGGACAATGCCTGCAACATGGACCAGATTGAAATTGCCATGAAGTTGACCAATGGGCAGAGGCAGAT
        GGAGCAGTTTGCGGGCATATATAAGGACCTGCAGCCAAAACAGGAAGTCTTTGCCTTCGCACCACCAGATTACAGCCTGC
        TACAGGATATCCGCAACCAGGGTGGCGTTATCCTGGTGGACGACAAGAACTTGCCCATCGTCTCTAGCAGCAACGGAATT
        GTGCCGAGCGTCTCCAGTGTTAATGCCGTGGCCGCGGCCTCCGTGGGAGTTGTGGGAGGCGTTGCTGGAGTAGTCGGAGG
        CGTTGGCGTGTCAAACGGCCTGGACTTGGCCTTCGGCATGAACATGCCCAACAATCCGCTGAGTGTTGCTTCCTCAAGTG
        TGCGACGTCCCCTGTTGCGAGACAATAGCTTCCGGATTCCATCGCCCATAATGCAACCACGCGGAGGAAGTGCCTGTGGG
        ATGTCCAGTGGGATGTCCAGCGCTGCTCTTGATTGGGAACTCAATGGACTGCGCAGCTCGCCAGGATTACACTTCAGTGC
        GCCGCGAACCACGCAGGCCATTCCGGGATGCATGGATCTGGTCAAGGTGCGTAACTCGAATGCTCTCTCGCTATCCTTCG
        CCACCGAGGGCCACGAGGACGGACAGGTGAGCCGGCCATGGGGTCTATGCGTTGATAAAATGGGCCACGTTCTCGTATCG
        GATCGCCGCAACAATCGCGTCCAGGTCTTCAATCCCGATGGCTCCCTAAAGTTCAAATTCGGCCGTAAAGGCGTGGGCAA
        TGGAGAGTTCGATCTGCCTGCTGGAATCTGTGTTGACGTTGATAATCGCATTATTGTGGTCGACAAGGACAATCACCGTG
        TGCAAATCTTTACCGCCAGCGGCGTCTTCCTGCTCAAGTTCGGCAGCTACGGCAAGGAGTACGGCCAGTTCCAGTATCCG
        TGGGATGTGGCCGTGAACTCGCGCCGCCAAATTGTGGTTACCGACTCGCGCAATCATCGCATCCAGCAGTTCGACTCTGA
        GGGTCGCTTCATCCGCCAGATAGTGTTCGACAACCATGGGCAAACCAAAGGAATCGCCTCGCCACGAGGCGTTTGCTACA
        CGCCGACGGGCAACATCATAGTGTCTGACTTTGACAACCACTGCCTCTACCTGATTGATCCAGACATCAACGACATTCTT
        TCCGTGAAGGGACATGAGGGCTCGGGCTTCCATGAATTTAATCGACCCTCCGGCCTGTGCTGTGACGACGAGGGCCGCAT
        TATAGTGGCCGATTCAAAGAATCAACGCATCCTGGTCTTCAATCAGAACCTGGACTTTATGTGGGATATCGAGGTGCGAC
        CCTCCATCAATCCCTTGATGCCGCCCACGCTGGACGAGAAAGATCGCACTTGCGATGTGGCCATAATGCCAGACGGTCGC
        ATTGTGTTCCTCATTGAACTGTCGCCAGACTCCAAGGAAGGGTCAAACCCTTACAAGCGGTTTGTGCACGTATTCTAAAT
        AAGGCCACGAGTGCCGATCTTTTTTTTTAGACCATTTACAAGAGCGAAACCTTAGCGTAGAGTTTCAAATAACATGACGA
        TTATGAGGAGGTGCCGAAACCGATTTAATAAGAAAAAATCTGAAATCATGAAAGTTAGCGAAAATTTTTAGCTTAAGTGC
        TACAACGATTACCTCGATATTGCTTAAGAGTTATGGTTACGATTTGGTAATTTACAATACAATACGAATTACACATATGT
        ATCTATGGATATCTATATCTATACGCATATGCATATATCTAGCGAATATACAAGCCCAACCAACTAGAACTATAACTAAA
        ACAAAAACAAAAAACAAAAACTAAAGCGAAAGGCAGGCGGTTGAGTAGGATTTAGGAGATATATATAAACGTAGGGTCCG
        TGAGCATTCAGTAGAGTTACCGAACCTAGTAAAAGATAATGCAAAGAGGGAACTCAACCATTTACTAGATGAAAATATTA
        TTACCTGTTAGTTAGACTGAAAGGCAGTTTGCTAGCTGATAGAAGGAGGTACGAACCAGGTCAGGTGGCGATTGTGTTTT
        TTTTTACGGGTTTGCTTAGCGGAATGAGGAAACTACATTCGACAAGAGTTACTAAACATGATTTGCAGAAACACTGTATG
        GTATGGTATTAATGTTTGTATTATATTTATAGTTCGTTTGTTCAGTTCTGTTTTTCGTTTATTTTAAAATTACTTTTTTT
        TTGGGACATACATATGTATTTTAATGATTTCCTTATAATTGAGACTGAGCATTTGACAACACGAACTTTGCGTGTACGGA
        AGCAAAGCGAAACAAAACAAAGAAACAAACAAAAAACAAGAAAATATTGATGGAACCCGCTGACTTTTCGTTGAACTTTA
        TACAAAGACTGATTAACTAAACCGCAATTTCGGAGCCAACTAAAGAACCATATATGGTGAGGCCAAAATAAGTGAAAGAG
        CAACACACTCAAATTGCAATGACATTGATAACGTAAAGTAACTTAACATAGCTTAACATACATACTTTCGCGCATATAGA
        GCGATACAGATATCATATAGATCCGATCATCCAGTCACGAATCATCATGGGCATAGCTGAAACCGAGTTTAACTGACATT
        CATCGACATATTTACCCATCCATCCATCCATCCATCCACTCACTCATACCGATCATGCATCACAGGGCTTTGTTTTTCGT
        TTGTCGTTACTTTGTAATTATTGTGAAAGGATTTAGCCACAGGATACAGATTCACGGCAGGTTGAAAGGAGGAGGAGGAG
        GAGGGAGGGGTTAGCTAAAATTAGTGGGACATTTTGGGAAGTAAACGAAACAGACCTGAAACAAAATAACGAAGAAGTTA
        TAATTTTTGACTCAATGTGTTCATTAGCATTTAGTAGACTTAGCGGGCGTGGCATAGTGAAAACGTATGGAAAATCCAGA
        GCAATATAAGGGCGTATTGAATACACATTTAGGTGACATGTTCCTCGCAAAAGAAACAAATAAAACAAAACAAAAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0300080
        4495
        FBtr0300081
        3290
        FBtr0300082
        7593
        FBtr0300083
        6021
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289361
        832
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0289357
        832
        FBpp0289358
        832
        FBpp0289359
        832
        FBpp0289360
        832
        Comments

        Transcriptional initiation site supported by short-capped RNA data (FBrf0209722).

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG42396-RE
        wech-RE
        Secondary FlyBase IDs
          References (0)