Open Close
General Information
Symbol
Dmel\CG13924-RB
Species
D. melanogaster
Annotation Symbol
CG13924-RB
FlyBase ID
FBtr0300120
Feature type
Associated gene
Evidence Rank
Length (nt)
1446
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            ATGTCCTTACTCATGGATTATTCCGCAGTCCTGAAGCCGGTCAACGAGTACAACATTGTGGACAGGATCAAGGAGGCCAA
            CAAGGAGCTCTTTGCGCTGGACGACGAGGCCTCCAATGGCAACGGCAAGGTGACGAAGGTGAAGTTTGCCCTGAATCTGG
            AGGATTACGAGCCCACGGAGCAGCAGAAGGATCTCAGTCCCAGTCCGCCCGATGAGCTGCTGCAGCAGTTGACGCAGCTG
            AAGCTGAAGCCCATTGCAGAGGAAGAACCAGCGGCTGCAGACGAGACCAAGGTGGTAGAAACGCCTCCTCCGATGGAAGA
            ACCCCAAGTAGATGATGAAGTGGAGGAGGAGATATGCGAGGAAATCGTGGACTTGAGTGAGGTGCCCCAACAGCCAGTGG
            TCCAGGAAGCCACTCCCATTGAGGATGAAGACGACTTCTCCGGCGTGGATGAGGCGGACCTGGATGACGATCCTCCGGCG
            AAGGACTCTTCTGTTCCGGGCTCCCTTCAACTGAGACAGGGCACTTTCGACCAGGATGACTCCGACCAGAAGAGTCTAAC
            CAATCTGCTAACCGAATCTGATTGCGAAGAGGAGGAACGCACCTTAAATGAGGCTCGCCAGAAGCTAAGGGATGCCTACA
            AGAATCTTTACAAGACCTTGGATCCGAAACAGCAAGAAACCATTGACAGGTTGACGGGAGCCGAAACTGAAGTGCCTTTG
            CCGGCGCCAGCGCCTGTGGTGGCTGCAGTTGAAGCCGAAGAGGAGGATGATCTGTCCATCATTGTGGCCAGCTATATTCC
            AGATGATTTTGAGCTCAACGAGCAGAGCATTTACTACAAGAAGGAGGAGCCCGATGAAGTCAGGGATTCGTGCACCACAT
            GTCCCAAGGCGACTTCCAAGACCTTCTTCACTTCGCGCAGTTTTAGCTTTCGCCGTCGGCCCAAGCCCACGCCCACTCTA
            TCCTCTGCCTCCGCTTCCACGACGTCTCCTTCGGTGCGGATGAACTACAAGATCTGCTGCGAGCACCGGCATTCGATTCA
            GGGCAAGCTACCCAGGTACACGGGCTACATGTCCGAGTACGGACTGACTGCCCAGCAACTGCAGCGGCGCGACCAGCAAC
            TGCGGCGGAAGCAGCGCTTCTCCATGGAGCAGACCATCAATCGCAACGAGCAGGAGCTGAAGAAGATGCAGGACAACGAG
            CGCGCCTTCACCACCTGGCTGAAGAACAAGATGCGCTATCCGATCAACAAGACCCGCAACATGTTCGATGCGCACAAAAG
            GCGGGGTAGTGTGGCCGCCGCCGGAAGTCCGCGCCAGCATCCCCAAGCTCATCCGCATCTGCACCAGGAGCAGGAGCAGC
            GCGGCGGACGGCGAAGGCGGCGGCGCGACAGCGGGGAAGTGGAGGTGCACGCCTATCGGCATCTGCTCGGCAGCTGGAAC
            AAGTAG
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0303153
            1485
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0289397
            481
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0292252
            494
            Comments
            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            CG13924-RB
            Secondary FlyBase IDs
              References (0)