Open Close
General Information
Symbol
Dmel\gol-RC
Species
D. melanogaster
Annotation Symbol
CG2679-RC
FlyBase ID
FBtr0300178
Feature type
Associated gene
Evidence Rank
Length (nt)
3193
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 51 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATCAGTCTTTTTCCGTACCTGCATCGAATCGGATATCCGACTGGTATATTAACGCTCCGAGTGGCGCGTATCGCGGATCT
        GTTCTAATTGCATTTTTGACTCGTTAGTCAGTTGTTTAGTCAATGAATAGTTGAGCCGCAACCAGCTCAGCTGCAGCCTG
        ACAAAGTAATATCTAAAGAAAACTGCGTTTCAGCCAGTGCCGCGGAGATACAGGGGCAGTCTATTAAAAGAATACACATA
        TCTGAATACATATATTTTAATCGCGTTCGCGTAACAAAAGCCAAATAGATAAGATAGCTACAACAAAAATTATTTCGAAA
        ATGCGTCGAGAAAATTAAGAAATGCAGATATATTTCAATAGTGCTATAGGGAAGATGTATCTACTGTTTTCTTACATATA
        TTGTTTGTGAGTGAGGGGGTAAAAACAGCTGTGGAGTTTTAGTTTTTTTTTAAAAAGCTTTTCCTTCCACATTTAATTGT
        CAGTTGTCGAATAAATAGGCTAAGAAGCGAATGCGACAGTCTGATTAAAATAGAAAACATCTGCTATACTCCTACGTGAT
        GTATATACGGAAAACGCTCCTACTGGCTTGCCTTGTTTTGCTGTTCGGGGGACTCCCGCCTCTCACCTTCCCTGCAACGA
        CCACTACCTTAGTGGCGGCCATGTCCATCGCAAATCAGGACTTGGAGCGCTACTTTCGACCAGGCAACGGCACTCACAGC
        TTCTCCGGCATGGAAGATCGTATTGCCGTGGACGTCTATAACTACGCCTTTCTTAACTGGTCATACGTAGAGCACGGTAA
        CATGCTGTGCAACATGGAATTCGCCCAAGAACAGGCCCGTTACGGAGAGGGCAAGGTGTTGAACGTAACGGGACGGTTAA
        TTCACATCACCGCCACGGACAACTTTAGTGACGATTACGCGTGCACGCCGTACATCCGAGGAACCTTGGGAGCACCCATA
        CCAGATAAAGGGGAGACATGGATTGCATTGGTGCGACGGGGCCGCTGCACCTTTGAGGAAAAAGTTAAACATGTCTACCA
        GCAAAATGCTGCCGGTGTTATTATTTATAACGACAAGCAAGTAATGCAGCTGGAGAAGATGCAGATCAAGGGCAAAACAA
        GAAACATAGCCGCCGTTATAACTTATCAGAACATTGGGCAAGACCTGTCTTTGACTCTTGATAAGGGCTATAATGTAACT
        ATTTCGATCATCGAGGGAAGACGAGGTGTTCGCACCATTAGCAGCTTAAATAGAACATCAGTGCTGTTTGTGTCGATTTC
        ATTTATTGTTTTGATGATTATTTCTCTGGTTTGGCTCATCTTCTACTATATTCAGAGGTTCCGTTACATGCAGGCGAAGG
        ACCAACAATCGCGCAATCTCTGCTCTGTTACCAAAAAGGCTATCATGAAGATTCCAACAAAAACCGGAAAATTCAGCGAT
        GAAAAGGACTTGGATAGCGACTGCTGTGCTATATGCATCGAAGCCTATAAGCCCACGGACACCATACGGATATTGCCGTG
        CAAGCACGAGTTCCATAAAAACTGCATAGATCCGTGGCTTATAGAGCATCGAACCTGTCCCATGTGTAAGCTCGACGTCC
        TGAAGTTCTATGGATATGTGGTGGGTGACCAAATCTATCAAACACCGAGTCCACAGCATACAGCGCCAATCGCCTCCATA
        GAGGAGGTGCCCGTCATTGTGGTGGCCGTGCCGCACGGGCCGCAGCCTTTGCAGCCGCTCCAGGCCAGCAACATGAGTAG
        TTTCGCTCCTAGTCACTATTTTCAGAGTAGTCGTAGTCCTAGCAGTAGTGTCCAGCAGCAGCTAGCGCCACTAACGTATC
        AACCACACCCGCAGCAGGCGGCATCGGAGCGCGGCAGACGTAACTCCGCTCCCGCCACAATGCCGCACGCTATAACTGCC
        AGTCATCAGGTGACCGACGTCTAAAATATCGTCAACTACCCACGAACAAGGCTTAGGTACAAAGTACAGCCTACTCTGTA
        CATAAAAACTCGTGTATTCAATAGTCAGCTATACCACCAGACCAATATTCATATTCCTTTAGTAAGACCCTTGCATCGGA
        ATTTGTATAGTTAAACTGGCGCAAACCCGTCCGTTGAGTCCAATGTTATATTCAGCCTAATTGTATTTTTTATTATTTTG
        AAATGTAAGTCTGTAAGTAGTCAATATGCATTTTGGTACAGATTAGGTTCACAGGTTATGCGAATGTGCAGCCTATATTT
        TTCAATGCCCTTACAAATGGACGTAGTGTAGCAAGTTCAAGCAGTTGACTGAAGTTTAACGTATTCCTCGTTTTACTTAA
        TTATAAGTTATGATAAAAAATTATAAGAGTAACGAAAAATCTTATGGATACATTCACTCATGTGTAAATAAACTCATTTA
        AGAGCAGTGTACTTAAAAAAGCTGATACAAAGACTTCCATTTTAATTTTTTAAAGCCCCACACACATTTACATGTATTTA
        AGCAACAATATAAAATACCGTTGGAAGTTTAACTTGAAAGCGGAATCATGAATACACTTAAATCGCATAGGGTTTAAGCA
        TATGATTATGTTCTATAAGACTAACAATTGTCGATAAAAGTATGCAAAGGAAATTACTTCCGAGTATGAACCCTTAAATT
        CAATACACTGAAATTTAATACCAATACAATTATAAACAGTGACTATATCTTAAAGCTGTAGAAAAGGTAATGGTAAATGC
        AATAAATATAGCAAGATCACCGACTGTGTTGCTAGTCACCCATAGACGGCTACACAAATCGCAGCCAGCGCATATTGTGA
        ATCAATGACTGCTGTAATATCACAGGTGCCAAAGTATTTGCTTTTAGTTTTTTATATTAAATAAAAATTGAAACATTTTT
        ATGTACTTACATTATTATTGCTTAATTCGTTTGATTGCATTTATTTTTCAATTGTTTTTATAGCTCATACATAAATTATT
        TATATTCCATTTATAACTTAGTTTAGATCATACATTTTATATATCATATATAATTATTAATAGTCGTTTTATAACGTTTT
        ATACGTTTTGAGTTTATGAAGAAATCCCGAGTAGTTTCTTGAATTTGTTATTTGCTTTATCACCAACTTTGAAACAAGAC
        CATGCTGTGCTAGACACCTCCAACATATTAAAGAACAACCCCAATAAACATATTGAATTTTGAGAATTTACCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0072459
        2583
        FBtr0300179
        2520
        FBtr0306330
        3725
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289415
        461
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072361
        461
        FBpp0289416
        601
        FBpp0297426
        461
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        gol-RC
        Secondary FlyBase IDs
          References (0)