Open Close
General Information
Symbol
Dmel\Nop60B-RC
Species
D. melanogaster
Annotation Symbol
CG3333-RC
FlyBase ID
FBtr0300227
Feature type
Associated gene
Evidence Rank
Length (nt)
2184
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 116 )
Sequence
TCCATTTTCTCGCAGCGCGCAACACGTGCGGAGGTTTCTCTCCGTCTATTAGTTGATTTAGCAGAAAACGTAGATAAAAT
GGCCGACGTGGAAGTACGCAAGGAGAAGAAAAAGAAGAAGATCAAGGAGGAGCCCTTGGACGGCGATGACATTGGCACGC
TGCAGAAGCAGGGCAACTTCCAAATCAAGCCCTCCTCCAAGATCGCCGAGCTGGACACCTCGCAATGGCCGCTGCTCCTG
AAGAACTTCGACAAGTTGAACATCCGTTCCAACCACTACACTCCGCTGGCGCACGGATCGTCGCCCCTGAACCGCGACAT
CAAAGAGTACATGAAGACTGGCTTCATCAACCTGGACAAGCCGTCGAACCCCAGCTCCCACGAGGTGGTGGCCTGGATCA
AGAAAATCCTCAAGGTGGAGAAGACAGGCCACTCCGGCACGCTGGATCCCAAAGTCACGGGTTGCCTGATTGTTTGTATT
GACAGGGCCACCCGTCTGGTGAAGTCCCAGCAGAGCGCCGGCAAGGAGTACGTGGCCATCTTCAAGCTGCACGGAGCCGT
GGAGTCGGTGGCCAAGGTGCGTCAGGGCCTGGAGAAGCTGCGTGGTGCCCTCTTCCAGAGACCTCCACTCATCTCCGCCG
TAAAGCGTCAGTTGCGCGTTCGTACTGTCTACGACAGCAAGCTGTTGGACTACGATGAAACCCGAAATATGGGTGTTTTT
TGGGTTAGTTGCGAGGCCGGCTCCTACATCCGTACCATGTGCGTCCATCTTGGTCTCGTACTGGGTGTCGGTGGCCAGAT
GCTGGAGCTCCGCCGTGTCCGCTCGGGCATTCAGTCTGAGCGCGATGGTATGGTGACCATGCACGATGTTTTGGACGCCA
TGTGGCTGTACGAAAACCACAAGGACGAGTCTATGCTGCGACGTGTGATCAAGCCGCTAGAAGGTCTGCTGGTCAACCAC
AAGCGCATTATTATGAAGGACAGTTCGGTCAACGCCGTTTGCTATGGTGCCAAGATTACATTGCCCGGTGTCCTGCGCTA
CGAGGATGGCATTGAAATCGATCAGGAGATCGTCATTTGCACCACCAAGGGTGAGGCCATTTGCCTGGCCATCGCCCTCA
TGACCACAGCCACTATGGCCTCTTGTGACCATGGTGTGGTGGCCAAGATCAAGCGAGTGATCATGGAGCGAGACACATAC
CCGCGCAAGTGGGGATTGGGACCAAAGGCGTCGGCCAAGAAGGCGCTCATTGCCGCCGGCAAGCTAGACAAGTTCGGAAG
GCCCAATGAAAACACACCTAAGGAGTGGCTGACCGGTTATGTCGACTACAATGCCAAGAAGCCAGCAGCTCAAGAAGTCT
CCCCCACAAATGGCTCCAGTGAACCCAGCAAACGCAAGTTAAGCACCTCCAGCGTTGAGGAAACTGCTGCGGCGGCGGTA
TCCGAGGAGACTCCTTCCAAGGACAAAAAGAAGAAGAAAAAGAAGCACAAGGGCGACGAGGAAGCCCCAGAAGCCGCTGA
GGAGGAGGCAGAGCCAGTAGAAAAGGAGAAGAAAAAGAAGAAGAAGAAGGACAAGGATAGGGACAGAGACGAAGCTCAGG
AATAGGAATCAGAAGTTTCTATAGGATTAGGTTTTAAAGAGAATTCTACGCTTTTTTGTAGAGGCACCTACCGATTGCTA
GCTGTTAGGTTTAAGGAGTGTTTTTATGTGTAGAAGTGCATACAAATTACAAATGCATTTAAGTGACATTCGCAATGCAA
TAAATTGAACATTTTATTGTGGAACTCTATTCGCTAGTTTCTTAGGTCTTAGCTTTTCCTTAGGTTTTTCAGATAGAAAG
GCAGGGAATACAGACAGCAAAGCTTGGAATACTGCTCAGAGGACAAAGCGGGAGTGACGGAAGATACGATCGGCGGAACG
AAAACTAAAAACGTGCTTCGAATAAACATAGGAATTAAGATTTGTTGATTAGGTTATGCAATATATGGACTATAACTTTA
ATAAAATAGATAAGTTCAAAAATTTTTTTGAAAATCATTGAATGCCACAGGAATCTTAAAAGATGTGCTTTTGGCGACTT
TCCACTGACTGTTCCAATTGAGTTCCATTTTATGCCCTTTTTTAGGTACAACACTGCCCAAGACATCATATAATACTTTA
TAAGCAAATAAAAGAAACATACAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0072258
1753
FBtr0100213
2218
FBtr0300861
3412
FBtr0304599
971
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289464
508
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072166
508
FBpp0099583
508
FBpp0290083
508
FBpp0293141
227
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Unconventional splice site invoked (GT-AT); sequence altered due to transposon insertion; this splice may not occur in vivo.

transcript_exception: non_canonical_splice_site (invoked due to sequence_alteration)

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Nop60B-RC
Secondary FlyBase IDs
    References (0)