Open Close
General Information
Symbol
Dmel\Tomosyn-RF
Species
D. melanogaster
Annotation Symbol
CG17762-RF
FlyBase ID
FBtr0300375
Feature type
Associated gene
Evidence Rank
Length (nt)
5290
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCCCAGTCGTCGAAGTTTTCACAGCTCTAACAGTTGAGACAACATTTTGAGAAATTGTCGTTTGTTTTGTCGTGCTTTTT
        GTTTAAACATTGCGTTGTGTTTTTTGTTTATCGCCCCCGTGTCGATCTGATCTGATTCGGTTCGCCAATCCAATTGGATT
        GGGCAAGCGCCACAAACGTTCAACAGCGGAGTGAATCGCCATGAAACAGCAAATATTTCGACCACTGTTAACCTAGTTTC
        ACATCTCAAAAATAAAACCAAACAACAAGGACGAACTCAGACCAGCACTGGCTCCTCTGTCTTCAATTACGCACAGCTCT
        ACCAGTATCTAGAGAATAACGAGTAAAGGCTACCAAGGACTCGAGGGAAGAGAATCGCCTGGGGCAGAGGAAGAAGCCAA
        TCCCCATACTTTTCGGTTCTCCTCGGACCAGAATCATCACCTCCCCCATCCCGACCCCGGCACTACCTTCCCGCTGAACC
        ACATACACTCTGTCCACTATCCACTATTCGACACCACCACACTCTGTGCATCCAACTATTTGGCCAACCATTAATCCTTG
        GGCGAGACCAGAGCAGCCCCATCGCATAACTGTGGATAGCAGAGCAGCCGGAGCACGAGGACGACTCATGTTACAAAAAT
        GAAAAAGTTCACATTCAAAGGAGTTCTAGATGGATTTCGACAAAGCGTTCAGCCCCAAGCCACACGACAGGAGCAGGAGA
        TTCAGGAGCAACTCAAGGCCGATCACTTTACGTTAAAGAAAACCTTTCGCCATGGCTTTCCATACTCGCCCACATCCTTC
        GCCTTCGATCCAGTACAAAAGCTACTAGCGATTGGCGACAAATCGGGCTACATTCGCATTTTGGGACGACCTGGCGTCGA
        TGCCCATGCCAAACACGAGGGCGAATCCGAGTGCGCCGTGCTCTTTGCCCAGTTCCTGGTCAACGAGGGCGCATTGGTCA
        CCGTCACCGCCGATGACACCATTCACTTGTGGAGCATTCGCCAAAAGACACCGCGCATTGTGCAGAGTCTGAAGTTTCAG
        AGGGAGCGCGTGACTTGCATACACCTGCCTGTGGGCAGCAAATGGCTGTACGTGGGCACCGAGAAGGGAAACATACACGT
        TGTTCACATAGATACATTTGCACTTAGTGGTTATATTATTAACTGGAATAAAGCAATTGAAGTGGTTAGAACTAGTCATC
        CAGGTGCTGTGATTGCGTTATGTGATAATCCATTGGATGCAAACAAGTTGCTTATTGCATTTGAGTGCGGGCTGCTTGTG
        CTGTGGGATCTGAAGGCGAAATGCGCTGAGCTGCGATGGCAGGCGGCCGAGGCCGTCAAGTCCCTGGCCTGGCACTACGA
        GGGCAAATATTTTGTGTCCTCGCACACGGATGGCTCCATTTGCTCCTGGCCCACGAAGCCGCAGGCTAAGCCGCAGTCGC
        AGGTCTGTCCGCATGCTAAAATCAACAAGGATGGCAATGCGGAGAAATGCAAGCCGATATATAAAGTTGACTTGAAGTCC
        AGCGCAACTGGGGAAACCTTCACAATTTTCTCGGGCGGCATGCCCTCGGAGAAGGGCTCCAAGTCCAACTGCATCACGGT
        GATGGTGGGCAAGGCCACCACGGTGCTGGAGATGGAGCACGCCGTTTGCGATTTCATAACACTCTGCGAGAATCCCTGGC
        CCTGCGAGACCCAGGAGCCGTATGCTATTGCCGTGCTGTTGCAATACGACTTAGTATTAATAGACTTATTAACACCCGGT
        TTTCCATGTTTTGAATCGCCTTATCCAATGGACTTACACGAATCACCTGTTACATGTTGCACATATTTAACCGATTGCCC
        ATCGGATTTGGTTCCTGCTTTCTATTCAGTTGGTCGCACAACGACAAGTAAAAAGAGCTGCTTCTCGGAGCGCGAATGGC
        CGATATCCGGTGGCGAGTGGTCGCCGGCGTCGTGCAGCTATTCGGAGATCGTGATCACCGGACACCAGGACGGCAGCCTC
        AAGTTCTGGGATTCCGGTGCCGGCACACTGCAGATCCTCTATAAGCTGAAGACAGCCAAGATGTTCGAGAAGCCGCGCTC
        CCACGTCGCCCACTCGCATCCGGAAAGCGACAATCCGCTGGCGGTGCACCTAATCTTCCTTTGCTCGGAATCGCGACGCC
        TGTGTGTGGCCGGCGCCATGGGACAGGTGATGCTCTTCAAGTTCCGCAAAGTGGAGTCCACGTCGGAGGTACTGGTGCTG
        GAGATACCCATACTCTATGAGAATTTTGATGACATTTATGGGACAAGTCCCGAGTGCGATTTTCTAACGGGCCATCAAGT
        GCAGAAGGCTGAGTCGAGTGATTCGGATAAGACGGCCGAGTGTTCGCTAAAGGTGCGCAATGGGGCGCAACGCAAGCCGC
        CGGGCTTCCAGTCGCAGCTGGTCTGCCTCACCACCGGACCAAATCGCCGGAACGTGCAGGTCACCTCGCTGTGCATCAGC
        TCCAGTTATGGCCTAATGGCTTATGGTACCGAATATGGACTTGTCATAATTGATATAATCCAAAAAATTTGCCTATTGAG
        TGTTGCATGCCCCGATCTGTATGGCGCACATGATCCTTACTCGCGAACACCAAAAAGTCCAAAACGTATTGAAAACAAAG
        AGGAGCAAAGCCGATCGCCCAGCTCAGATCAGCTGAACGACACGACCAGTCCGGATAGTCCGTCTCTCGAATTTGTACCG
        GAGGCTGGCGAAACATCGGCCCACGATGGCGTGGCGACGGCAACTAGCTCACGTCCCAGTTCACCGGACCCGGTGGTGAA
        CAGTGCTCGTGAAACGCTGCTCAGCGGATCGGCAGCGGCAACGGCGGCTGCGGCAGCATCGGCGGCTGTCATGATGGCCA
        AGAGTCCCCAGCGGGATGATGCAGCTCCCAAGGAGCTGCAGGACAGACGAAAGTCCATGTCCTGGAAAACGTTCAATTTG
        AAGCGTCAATTATCGAAAGTCAATATGAAGATCGGCGGCCTGAATGTCAATACCGATATGGAGTCGCTAAAGAATAGCTC
        CATTTTCTACACGCCCAAGGAGGTGTCACCGGAGGCTGCTACGCCACCGGCAACAGAAGAGGAGGCAACGCCGGAGGGCA
        AGGAGGACGAGTCCCTGGATGATGGCGAAATGGCGACCAACGCGGGAGCAGCAGCAGCTGCATCACCATCGCCGGCAGTT
        CGTGGCAAATTTCGCTCATCCACCACGGATTCACCTGATGAGGGCGCCAGCAGTAGCATTGCCAGCGGCATTCGTCGTGT
        GGACTTTGAACAGCCGGCTGGGGTCGAGGTGGAGCGACCAAACAACCTGCCACTGGCGGATGCACCAGCTCCACTGAAGC
        CCGCCCGTCAAAAGTTCAAGGAAAAGTCGCGCGATCAGCGACTTTTATCCGTTCCGAACATTAAGTATCAGCCGCGAGAT
        TCGCGTGGCGGTGCTCGGAACCTCAAGAATGATGTCTCACCGCTGATGGGCGGTGGTGGCGGTGGAGGAGGCGTTGTTGG
        TGCCAGCAGCGGCATTGGTGGAAGCGTCGCTGGAGGCAAGAAGATACATAAATTGGATGGAACTTTCTCAAGATCCAGAT
        CATCGTCAATGTCCAGCATTGATATGTCTTCCTCTGAATCTGTTACCTGTTTAGCTTTTATCGAGAGTTATGCAAAACGA
        AATGATATTTTGACACTTGTTCCTACTTTGTGGATTGGAACTAGTTTCGGTTCGATACTGACATTGTTCATCACCATGCC
        CGAGCGAGATGTGCGCAAATCTCAGCCAGTATTGATAACAATAAATGGTGGCCCCGTGGTACGACTCAAAGGATCCATAA
        CTTCCATGTCTTTTTTAGACTCATACGGTTCGATCATACCCTATACGTTTGAGACCTGGCGTGACGAGAAGAGGGACAAC
        AAAGATCGCACACCAACAAAGAGCAGCAGCCGCACCAGTCCCACATTCACACCGACAACTGCCAATACATTATCAAACAC
        TTCGGTCGCGGGTGGTGCGTCCGCAGGCGGAGGAGCTGGCGGCGGTGGTGGTGCCGGCGGTGGTGCGGCCAGCGGTGGCG
        CAGCCGCAGGAGGGCCAGCCGGCGGTGGTGCCGGAGCAGGATCGGCGGCTGGAGCGGCCGGCGGCGTTGGAAGCGGTGTA
        ACCAGCGGCGGGGGGATGAGCAGCAGCAGCGCCAGCAGCAGCGGCATCAGCGGAAGTGTGAGCACCGGCCTGGAAACTCT
        CACCGATCGACAATACATCGTTATCGCAAGCGAGAAGCAAACAAAAGTCTTCGATGTCGCCAACCAGTGCTGCATCAACC
        GCATACAATTATCGGAAATGGATTTTGCAGTCAAGGCAGAAACTATCACGATGAAAGATGGCTCTTGCTTAGCAACCTAT
        CTTTCGAATGGCCATCTAATGGTACATAGTCTTCCTAGTCTAAAACTGTTATTGGATACTGATTTCTTACCACTTATGGA
        ACTAAGTTTTCAAACAAAATGTAAACAGGGAATTGTGGATCCAATGCTTTCGATATGGGGTCAACAGATCATTGTTCATG
        AAGATACAACTCAAATATCAAAAATATTTTGCTTTAGTCATAAAGGTCATGGATTGTACATGGCATCGCCCACCGAAATT
        CAAAAATTCACGATATCATCGGAATTTTGTCAATTTATTTTGGAGATGATGGGTGAACTATATACGGTACACGAAATGCC
        CGAACAGCCGAAGGAGGGTTTCTTCAAGGGTCTATTTGGTGGTGGCGCCAAACTCCTGGATCGCGAGGAGCTATTTGGCG
        AGCAGAGCGGGAAACCGAATCGATCGGTGGCACGGCACATACCCGGCCCCAATTTGGAGCAGCTCGGCCAGAGGGCTTCC
        ACCGCCGCATCGGAGATCAGCCGGGCGCACCAGCTGGCCATGGAGCGCGGCGAGAAGCTAAATTTGCTGGAGGAGCGCGC
        CGAGCGCATGGCCAACACTGCTCAAGATTTCAGCGGCACTGCGCATCAATTAATGCTTAAATATAAAGACAAGAAGTGGT
        ATCAGTTGTAAAATATCTATTTTAGGAGCCAATTCTACCACAGTTATTGTAATATTGCTTTTATAACACTTTCTACTACA
        TTACGAGTAAAGTACACTTATTTAATTTCTGTTTTCAAGTCGTCACGTTATTTACAAAAACCGAAAACCAACAAAAAAAA
        ACAACAAAAACCGAAAATTCACAAAAACAAAAAAACTGAAAGAGAAAACCCAACCAAAAAAAAACTGTTTTTAATAAAAA
        TATATAGACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073678
        5490
        FBtr0307898
        4541
        FBtr0307899
        5330
        FBtr0307900
        4687
        FBtr0340406
        5041
        FBtr0340407
        5062
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289604
        1470
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073511
        1470
        FBpp0300332
        1254
        FBpp0300333
        1470
        FBpp0300334
        1254
        FBpp0309352
        1387
        FBpp0309353
        1387
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Tomosyn-RF
        tomosyn-RF
        Secondary FlyBase IDs
          References (0)