Open Close
General Information
Symbol
Dmel\TfIIEβ-RB
Species
D. melanogaster
Annotation Symbol
CG1276-RB
FlyBase ID
FBtr0300449
Feature type
Associated gene
Evidence Rank
Length (nt)
1121
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTCCGGTTCCACGGACAGCTGAGCAGGCATTGTTTAGATTTTGTAAATTGTTGATTTCTCGCAGCAGAAAGTTTTTTTTC
          GTAGAGCTAAATAATAAAAAAAAACATTCGAAATGGATCCAGCACTGCTTCGCGAACGCGAGGCCTTCAAAAAGCGGGCG
          ATGGCCACGCCCACGTGAGTACCGCACTTGTGGCCCCTCTGATAAAGATTGCTTCTCGAAAATTACATGCTATCCTTTTA
          AAATAGCGTGGAAAAGAAGTCCAAGCCCGATAGACCAGCTCCACCGCCGCCTAGCGATGATTCCAGGCGCAAAATGCGCC
          CGCCCAATGCTCCCAGGCTGGATGCCACAACATACAAGACCATGTCCGGCAGTTCCCAGTACCGCTTTGGAGTGCTGGCC
          AAGATTGTGAAATTCATGCGCACACGTCACCAGGACGGCGACGACCATCCCCTGACCATCGATGAGATTCTGGACGAGAC
          CAACCAGCTGGACATTGGGCAATCCGTTAAGAATTGGCTTGCTAGCGAGGCTCTGCACAACAATCCCAAGGTGGAAGCCA
          GTCCATGTGGCACCAAGTTCAGTTTCAAGCCAGTCTACAAGATCAAGGATGGCAAAACGCTGATGCGTCTGCTCAAGCAA
          CATGATTTAAAGGGCCTGGGCGGCATTTTGCTGGACGATGTCCAGGAATCTCTACCACACTGCGAAAAGGTGCTGAAGAA
          CCGATCAGCCGAAATACTTTTTGTTGTTAGACCCATTGACAAAAAGAAGATTTTATTTTACAATGACAGGACTGCTAATT
          TTTCGGTGGACGACGAGTTCCAGAAGCTATGGCGCTCGGCTACGGTCGATGCAATGGACGACGCCAAGATTGACGAGTAC
          CTCGAGAAGCAGGGCATTCGCTCCATGCAGGACCATGGCCTCAAGAAAGCAATTCCCAAGCGCAAGAAGGCGGCCAACAA
          GAAGCGGCAGTTCAAGAAGCCCAGAGACAACGAACATTTGGCCGACGTTCTGGAGGTCTACGAGGATAACACACTAACGC
          TGAAGGGTGTGAACCCAACGTAGAATAGAGACATTAGATTATACAAATAAAAACCACTCTCAATGGAATTAAGTACACTC
          G
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073234
          1049
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0289677
          249
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073090
          292
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          TfIIEβ-RB
          Secondary FlyBase IDs
            References (0)