Open Close
General Information
Symbol
Dmel\Aldh-III-RO
Species
D. melanogaster
Annotation Symbol
CG11140-RO
FlyBase ID
FBtr0300481
Feature type
Associated gene
Evidence Rank
Length (nt)
2448
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TGACTTTGGGCCGGGAATGCGTGTGCATCTGCGACCTGTGATTAGCGCCGAAGACCCCCATTAAGAAATTCAAATCAAAA
          GTCGAGATTTGAGATTTAAGATTCGAGATTCGAGATAATCAAGAACGCGAAGAAAACTGAAACTGGAAAAGCGACGACGA
          CTGCGGGTACGGGCCAACTTGGAGCGCTTAGCCGGGCTTAGACGTGTTTCGAGCGCGGCGGCGTCAGGTGAATCCGAGAT
          TCAATCCTAATTCGAATTCGAATCCGAGTGCCCGCTTTTGTGCTATTTAAAAGTGTCCCCAATAGCGAATTTATAACCAA
          ACAAAAAAACACTACGATAATGTTTGACAACGCGATTAAACCTCATCCGGAGGCCAATGGAGCTCCAATAAATGCAGGAG
          ATCGGCCGATAACTACTGTCATTAATATTGAACCAGAACCAGAAACCGAAAGTCCAATTGGGATCTTCACATCACAACCG
          GAAAGTCAACAACAACAACCCGAGCAGCTCCAATCCGAATCCGAGTCCGACAGAATGGCCAATTTTGACGATACGTTGCA
          ACGCGCCCGCCTTGCCTTTTCCAGTGGAAAGACCAGGAATGTCAGCTTTCGACGCAAGCAGCTGGAGAATTTGCTGCGTT
          GCTATGAGGAGCACGAGAACGAGATCATCAGCGCCTTGGAGGCGGATCTGCGACGTCCCAAGCAGGAGAGCCTCATCGTG
          GAAACGGAATTCATGAAGAACGACATCAGGCACATCCTATTCCAGCTCGACGAGTGGGTGCAGTCGGAGAAGCCGCCCAA
          GTCGTTTGTGAACATGATGGACGACGTCCAGATCTACAATGACCCCTTCGGAGTGGTTCTGGTGATCGGCGCCTGGAACT
          ACCCGCTGCAGCTGCTGCTCGTGCCAGTGGCTTCCGCCATCGCCGCCGGAAACTGTGTGGTGATCAAGCCCAGCGAGATT
          GCCGCCAACTGCGCCAAGTTCATTGCCGATGTCATTCCAAAATATTTGGATAATGATTGCTATCCAGTTGTCTGCGGTGG
          ACCCAGCGAAACGGCGGAGCTGCTCAACCAGCGTTTCGACTACATCTTCTACACGGGCTCCACGCGCGTAGGCAAGATTA
          TCCACGCCGCGGCCAACAAGTACTTGACCCCCACCACCTTGGAGCTGGGTGGCAAAAGCCCCTGCTACATTGACAAATCT
          GTGGACATGCGCACTGCGGTCAAGCGCATCCTGTGGGGCAAGCTGATTAACTGCGGACAGACCTGCATCGCTCCGGACTA
          CATCCTCTGCTCCAAGGAGGTGCAGGAGAAGTTCATCGTGGAGGCCAAGGACGTGCTGAAGGAATGGTACGGCGAGAATA
          TCCAGAGCAGTCCGGATCTAAGCCGTGTGATCAACGCCAACAACTTCCAGCGCCTTCTTGGCCTAATGAAGTCCGGCCGC
          GTGGCCGTCGGAGGTAACTACGATGCCAGCGAGCGTTTCATCGAACCCACCATCTTGGTGGACGTGAAGGAGACCGATCC
          CATCATGGAGGAGGAGATCTTCGGCCCCATCTTGCCCATCTTCAATGTGGAGAGTGCCTACGATGCCATCAAGTTCATCA
          ATGCCAGAGAAAAGCCGCTTGTAATTTACGTGTTCTCCAACTCGAATAAGCTAGTTAAGGAGTTCAGGCGGAGCACCACC
          AGCGGCGGATTCTCCAGCAACGAAACCATAATGCACTGTGGAGTTGATGTGCTGCCCTTCGGAGGCGTCGGCATGAGCGG
          CATGGGCAGATATCATGGAAAGTACGGCTTCGAGACCTTCACGCACAAGAAATCTTGCCTGGGCAAGGACTTATCCCCGT
          TGGGCGAGAAGTTGTCATCAGCTCGGTACCCACCCTACTCGGACCGCAAGGGATCGCTGCTCTCGTTCCTGCTGCGCAAG
          CGCCGTCCGCTGCCCAACCTGCATCTGAGCCACGTGCTGGCCATCGGACTGGGAGTCGGATTGACGGTGCTGACCAACTA
          CTACCTACAGGGCAAGCTGTTGTCGAAGTAGAAACTACATATGATGCGAGCCGGAGCTGGGTGAGCCTGCGCCAGAGGAT
          TCCCAATCAACCAACCACTTAATATTGTAATTGTTTGCAATAAATGTTTAGGCGTAGGCATAACTAACTTCATTGCACAT
          TCAGACAACTCACATAATAGAAACTACTGGGCCATCTGGTGTTGTATTTTACACTGCAATATGAAATTATATATATTTGA
          AATCGTCGACAAACGCCTGCAATTTTGTACTTTCAGAAAAGCTCAACTGATTAATGGGCCGAGAACTTTTTTCTTTTTAT
          ACGCATATCGGTGGGTGATGTGAAGCTTTGGATACTTCGATATACATATAGTTATTGTTATTTAGTTGCTATTTAATACA
          AATGTGAATGCTGTAATGTAATGTACGACAAATAAACAGTCAAAAATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0088996
          1840
          FBtr0088993
          2305
          FBtr0300477
          2233
          FBtr0300478
          2144
          FBtr0300479
          2052
          FBtr0300480
          2352
          FBtr0310674
          2306
          FBtr0308198
          2923
          FBtr0310675
          1840
          FBtr0310676
          2233
          FBtr0336912
          2115
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0289708
          563
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0089176
          497
          FBpp0088066
          498
          FBpp0289704
          498
          FBpp0289705
          498
          FBpp0289706
          498
          FBpp0289707
          563
          FBpp0302794
          563
          FBpp0300518
          564
          FBpp0302795
          497
          FBpp0302796
          498
          FBpp0307851
          501
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Aldh-III-RO
          Secondary FlyBase IDs
            References (0)