Transcript Dmel\CG10320-RE

General Information
Symbol	Dmel\CG10320-RE	Species	D. melanogaster
Annotation Symbol	CG10320-RE	FlyBase ID	FBtr0300680
Feature type	mRNA	Associated gene	Dmel\CG10320

Evidence Rank	Strongly Supported	Length (nt)	405
Evidence Score	15

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent	AF171778 yak-ad_CG10320
End(s) extend beyond the annotated transcript, internally consistent	TA01433
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent	54721 74210 74241 80601 80897 522972 CK01.27B.E2 Dmel_dig_000700_0671_3616 Dmel_dig_005333_0659_3269 Dmel_dig_005785_0705_1216 Dmel_dig_009160_0685_2061 Dmel_dig_010017_0645_2880 Dmel_neb_013188_0688_1020 Dmel_neb_014862_0406_1989 EK180833 EK204048 EN03146 ESG0116a.B21_F11 FGM306F06
End(s) extend beyond the annotated transcript, internally consistent	Dmel_neb_011936_0097_0916
Sequence
	CAAATCGTTTACTGCTCATCTCTAAGTCAACTTACAGCAATGGGCGGACA TCACGGCGAACCCTACACGGTGCCCCACGCATCGACCTACAAGGTGGAGA GTGTGCCCCAACTCGTGGAGGTGAAGGAGGCTCTGGGCCGCCAGGGATTG AAGGATCCATGGCTGAGGAACGAAGTCTGGCGCTATGAGCCCAAGGCCTT CGGCACCCACAGATCCCGCCTGAACACCTTCCTTTTCCGCGGACTCGGCG TGGGATTCTGCGCTTTCCTGGCCACCGTCGCCGTGGAGTACGCGCTGGGC ATTGGCAAGGGTCAGGGCGGCCATGGACATGGCCACGGTCACGAGGAACA CGGAGATAAGGGCCACCATTAGATATACTGAATAAACCCATTGTGCTATC GCTCC
Other Products of this Gene
Other Transcripts
	Name FlyBase ID Length (nt) CG10320-RA FBtr0071663 422 CG10320-RB FBtr0113101 400 CG10320-RC FBtr0113102 520 CG10320-RD FBtr0300679 525
Polypeptides
Derived from THIS transcript	Name FlyBase ID Length (aa) CG10320-PE FBpp0289904 110
Derived from OTHER transcripts	Name FlyBase ID Length (aa) CG10320-PA FBpp0071580 110 CG10320-PB FBpp0112014 110 CG10320-PC FBpp0112015 110 CG10320-PD FBpp0289903 110
Comments
	Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NM_001169770
Synonyms
	CG10320-RE
References ( 1 )
FlyBase analysis	FlyBase Genome Annotators, 2004, Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. [FBrf0166453]