Open Close
General Information
Symbol
Dmel\Kcmf1-RD
Species
D. melanogaster
Annotation Symbol
CG11984-RD
FlyBase ID
FBtr0300743
Feature type
Associated gene
Evidence Rank
Length (nt)
2394
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 110 )
Sequence
ATTCGGTATTTTGCGCTCAAGCGGCAAACGGTCGCACTGCAGATCCTCTCAATCTAAATTCAAAAACTGGAATCCTCCGA
AGCCCCGCAAGGAACCCACATAAAACCAGCACAGCTGGAAGTTAAAAGCAAGTCAATCTTAAGCGGGAGACGCTCTCCTG
ATCGCTTGGAAGTTGAAGCCAAGCCTACTGCCGCTGCCGAATAATGAGTCGACATGAAGGTGTCAGCTGCGATTCATGTC
TCAAGAGCAACTTCAACGGACGGCGCTACAAGTGCTTGATCTGCTATGACTACGATCTGTGTGCCGATTGCTACGAGGAT
GGCGTCACCTCCACGCGCCATTTGGTCGAGCATCCCATGCAGTGCATCCTCACCCGCTCCGATATCGAGCTGTACTTTGG
CGGCGAGATGCTAGCCTCCGACCAGCCGCAGAGCTTCACCTGTCCCTACTGCAAGAAGATGGGCTTCAGCGACGCCACCC
TGCTGGAGCATGTCTCCGCCGAGCACACGGAGACCAGTCTAGAGGTGGTCTGCCCCGTATGTGCCGGTCTGCCGGGCGGC
GAGCCGAATCTAGTCACAGATGACTTTGCCGGTCACCTCACCCTGGAGCATCGCCAGGGACCGCGCGAGCTGATTTCCTT
TCTGGATGAACCCTCGGCCATCCGTCATGGCGGTGGAGTGCGTCGCATCCCAGGACGCACCCTCGGTGGACCACGGACGC
GTCGGTCCAACATGCACTTCAGTTCGTCTAGCGGTCTATCAGCCTTGTCGCCTTCGGGACGGGAATCGGTGGATCCCATT
GCGGAACTGTTATCGCAGCTTTCCGGCGTGCGGAGGGGCGGACCGCCCACATCTCAGCTGCAGCAGCTACAGATGCAGAT
GCAGTTGGATCGCCAGCAGGTGACGGCATCGCGCCAAATCGATCGGCTGCCAAGGCGTGCGCATCCCATAGTCTCAACAT
CGAACTCGAATGCCGCCATGGCCGAGGTGATCAGCGGCGGAGCGGGCGGCAGTGGAGGCAGTGGCGCAGTTGGAAGCGGC
AGTGGAGGCGGCAGCGGGGCAACTGCTCCGCCCAACCTGCGCACCACTGAGTGGCCGGTGACAGCCAGCTTCTCGACATC
GGCCAGCAATCATTCGCAAACTCAGTCGAGTCTGGCCGCCAACAGCCTCAATGCCAGAGAAGCGATCGGAACGAGCAGCA
GTGCAGGCAGCAATGTCCTGGGCATCAGCGTGGGCGTCGGCGGAACGGCCAACGGCAACGGTGGAGCAGGTTCATCCGGT
GTGGCAACTGGAGCCGGAGGAGCTGGACAGGGAGGAGGCCAGGGTGGTGCGGCAGCTGGCGAGTCATTCTTGTTGGCCCA
ATTCATGCAGCCCACCTTTACCGAGGCCGAGTGGGCGGTCGTGGAGAGTATGCGAGCAGATCGCTCCATGTTTGTGCAGT
CGCTGATGCTATCGATGCTCTGCACTGAGGCACTGGATTTGAATGCCTCCGACGAGAGCCTGGCCAAGAGTGATAATGTA
AATAAGGGGCAACAGCAGCAGCAAGAGGATGCCGAGGCCGAGGCGCAAGCGGAAACGCTGTTGAACAACAATGCAGATGT
GGAGCAGCAGCAGCAGCAGCAACAGCTACAGCCGGCGATGGTGCGACAGGTGAATCAAATGCAACAAACCTCGCCAGAGG
ACTTTGTGTGCGACGAGTATCGCTATAAAAACAAAAAGGCCAACACAACACAAACGAGCGGTACTGGCGGATTGGGGGGA
GCTGGAGCAACTGCAGCCCCTGGTGGTGGTGCTAGTGGAGCTGGCACTAAGCCAACAGCTGATAGAGGCATCGAGAGGCG
CAGCGGACGTCCGCCGCCAGGAGAGATGGCCACGGGCTCGCAGCAGCCACAACAGCAGCAGCAGTCCACGGCTAATCCGG
CAGCGTCTCAGCAAAAATACAAACAGAACGCTAGTGCAGCGACGGCGGCGGGAAACACAAATCAAATTCCCGACACTAGG
TAGTGCCTCTGATGATGATGATCACCACAAATTGCATCAACAACAACAGTAACAGCAACCACACCCAATGTAGCTGCAGC
AGCCACAAGAAATCTGTCACCACCACTAAACACCGCAACAGCAAGGGAAGCAGAAAGCGAAACAGATGGAACTAAAACCA
ACACAGCCGTTAAAGTAACAACCGGAGTGGGGGATAGCTGCTGCTCTGGAGGAATCCGAATCGTCTTAAGCAGTTGCCGA
CGCAACCGCCGCAGCAATGTCGTCGAAAGGAAAACTATATTATGTATCGTTTATTAAATATATTAAAATTTATATAATTA
TAAAAAGATGAGGAAGATGTGCAGCAAGAAAAATTATTGTAATCATTGAATTAATTATAATTTAAAGAAACCAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0300744
2481
FBtr0300745
2417
FBtr0300746
2488
FBtr0300747
2445
FBtr0300748
2545
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289967
599
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0289968
599
FBpp0289969
599
FBpp0289970
599
FBpp0289971
599
FBpp0289972
599
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Unconventional splice site postulated (AT-AC).

transcript_exception: rare splice-site pair, AT-AC intron

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG11984-RD
Kcmf1-RD
Secondary FlyBase IDs
    References (0)