Open Close
General Information
Symbol
Dmel\Kcmf1-RE
Species
D. melanogaster
Annotation Symbol
CG11984-RE
FlyBase ID
FBtr0300744
Feature type
Associated gene
Evidence Rank
Length (nt)
2481
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACTGTTATTTCCCAGCTGCCCAAATCAGCCTGTCTGCCCAAAGTTCTTGCAAAAGCTCTTCTTAACCAAATGGGGACCGC
          GTCTATTTGTACGGCCGCCACTGTGCCATGACTGGCGGCGTTGCCAGATATCCTCTCAATCTAAATTCAAAAACTGGAAT
          CCTCCGAAGCCCCGCAAGGAACCCACATAAAACCAGCACAGCTGGAAGTTAAAAGCAAGTCAATCTTAAGCGGGAGACGC
          TCTCCTGATCGCTTGGAAGTTGAAGCCAAGCCTACTGCCGCTGCCGAATAATGAGTCGACATGAAGGTGTCAGCTGCGAT
          TCATGTCTCAAGAGCAACTTCAACGGACGGCGCTACAAGTGCTTGATCTGCTATGACTACGATCTGTGTGCCGATTGCTA
          CGAGGATGGCGTCACCTCCACGCGCCATTTGGTCGAGCATCCCATGCAGTGCATCCTCACCCGCTCCGATATCGAGCTGT
          ACTTTGGCGGCGAGATGCTAGCCTCCGACCAGCCGCAGAGCTTCACCTGTCCCTACTGCAAGAAGATGGGCTTCAGCGAC
          GCCACCCTGCTGGAGCATGTCTCCGCCGAGCACACGGAGACCAGTCTAGAGGTGGTCTGCCCCGTATGTGCCGGTCTGCC
          GGGCGGCGAGCCGAATCTAGTCACAGATGACTTTGCCGGTCACCTCACCCTGGAGCATCGCCAGGGACCGCGCGAGCTGA
          TTTCCTTTCTGGATGAACCCTCGGCCATCCGTCATGGCGGTGGAGTGCGTCGCATCCCAGGACGCACCCTCGGTGGACCA
          CGGACGCGTCGGTCCAACATGCACTTCAGTTCGTCTAGCGGTCTATCAGCCTTGTCGCCTTCGGGACGGGAATCGGTGGA
          TCCCATTGCGGAACTGTTATCGCAGCTTTCCGGCGTGCGGAGGGGCGGACCGCCCACATCTCAGCTGCAGCAGCTACAGA
          TGCAGATGCAGTTGGATCGCCAGCAGGTGACGGCATCGCGCCAAATCGATCGGCTGCCAAGGCGTGCGCATCCCATAGTC
          TCAACATCGAACTCGAATGCCGCCATGGCCGAGGTGATCAGCGGCGGAGCGGGCGGCAGTGGAGGCAGTGGCGCAGTTGG
          AAGCGGCAGTGGAGGCGGCAGCGGGGCAACTGCTCCGCCCAACCTGCGCACCACTGAGTGGCCGGTGACAGCCAGCTTCT
          CGACATCGGCCAGCAATCATTCGCAAACTCAGTCGAGTCTGGCCGCCAACAGCCTCAATGCCAGAGAAGCGATCGGAACG
          AGCAGCAGTGCAGGCAGCAATGTCCTGGGCATCAGCGTGGGCGTCGGCGGAACGGCCAACGGCAACGGTGGAGCAGGTTC
          ATCCGGTGTGGCAACTGGAGCCGGAGGAGCTGGACAGGGAGGAGGCCAGGGTGGTGCGGCAGCTGGCGAGTCATTCTTGT
          TGGCCCAATTCATGCAGCCCACCTTTACCGAGGCCGAGTGGGCGGTCGTGGAGAGTATGCGAGCAGATCGCTCCATGTTT
          GTGCAGTCGCTGATGCTATCGATGCTCTGCACTGAGGCACTGGATTTGAATGCCTCCGACGAGAGCCTGGCCAAGAGTGA
          TAATGTAAATAAGGGGCAACAGCAGCAGCAAGAGGATGCCGAGGCCGAGGCGCAAGCGGAAACGCTGTTGAACAACAATG
          CAGATGTGGAGCAGCAGCAGCAGCAGCAACAGCTACAGCCGGCGATGGTGCGACAGGTGAATCAAATGCAACAAACCTCG
          CCAGAGGACTTTGTGTGCGACGAGTATCGCTATAAAAACAAAAAGGCCAACACAACACAAACGAGCGGTACTGGCGGATT
          GGGGGGAGCTGGAGCAACTGCAGCCCCTGGTGGTGGTGCTAGTGGAGCTGGCACTAAGCCAACAGCTGATAGAGGCATCG
          AGAGGCGCAGCGGACGTCCGCCGCCAGGAGAGATGGCCACGGGCTCGCAGCAGCCACAACAGCAGCAGCAGTCCACGGCT
          AATCCGGCAGCGTCTCAGCAAAAATACAAACAGAACGCTAGTGCAGCGACGGCGGCGGGAAACACAAATCAAATTCCCGA
          CACTAGGTAGTGCCTCTGATGATGATGATCACCACAAATTGCATCAACAACAACAGTAACAGCAACCACACCCAATGTAG
          CTGCAGCAGCCACAAGAAATCTGTCACCACCACTAAACACCGCAACAGCAAGGGAAGCAGAAAGCGAAACAGATGGAACT
          AAAACCAACACAGCCGTTAAAGTAACAACCGGAGTGGGGGATAGCTGCTGCTCTGGAGGAATCCGAATCGTCTTAAGCAG
          TTGCCGACGCAACCGCCGCAGCAATGTCGTCGAAAGGAAAACTATATTATGTATCGTTTATTAAATATATTAAAATTTAT
          ATAATTATAAAAAGATGAGGAAGATGTGCAGCAAGAAAAATTATTGTAATCATTGAATTAATTATAATTTAAAGAAACCA
          C
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0300743
          2394
          FBtr0300745
          2417
          FBtr0300746
          2488
          FBtr0300747
          2445
          FBtr0300748
          2545
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0289968
          599
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289967
          599
          FBpp0289969
          599
          FBpp0289970
          599
          FBpp0289971
          599
          FBpp0289972
          599
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Unconventional splice site postulated (AT-AC).

          transcript_exception: rare splice-site pair, AT-AC intron

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG11984-RE
          Kcmf1-RE
          Secondary FlyBase IDs
            References (0)