Open Close
General Information
Symbol
Dmel\Kcmf1-RF
Species
D. melanogaster
Annotation Symbol
CG11984-RF
FlyBase ID
FBtr0300745
Feature type
Associated gene
Evidence Rank
Length (nt)
2417
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 47 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGCAGGGAAAACAAAAGAAGGAAATGCCATGTCCTTCTCCCTGCAATTTTTGCCCTGCAATTTCAATCCTCTCAATCTAA
        ATTCAAAAACTGGAATCCTCCGAAGCCCCGCAAGGAACCCACATAAAACCAGCACAGCTGGAAGTTAAAAGCAAGTCAAT
        CTTAAGCGGGAGACGCTCTCCTGATCGCTTGGAAGTTGAAGCCAAGCCTACTGCCGCTGCCGAATAATGAGTCGACATGA
        AGGTGTCAGCTGCGATTCATGTCTCAAGAGCAACTTCAACGGACGGCGCTACAAGTGCTTGATCTGCTATGACTACGATC
        TGTGTGCCGATTGCTACGAGGATGGCGTCACCTCCACGCGCCATTTGGTCGAGCATCCCATGCAGTGCATCCTCACCCGC
        TCCGATATCGAGCTGTACTTTGGCGGCGAGATGCTAGCCTCCGACCAGCCGCAGAGCTTCACCTGTCCCTACTGCAAGAA
        GATGGGCTTCAGCGACGCCACCCTGCTGGAGCATGTCTCCGCCGAGCACACGGAGACCAGTCTAGAGGTGGTCTGCCCCG
        TATGTGCCGGTCTGCCGGGCGGCGAGCCGAATCTAGTCACAGATGACTTTGCCGGTCACCTCACCCTGGAGCATCGCCAG
        GGACCGCGCGAGCTGATTTCCTTTCTGGATGAACCCTCGGCCATCCGTCATGGCGGTGGAGTGCGTCGCATCCCAGGACG
        CACCCTCGGTGGACCACGGACGCGTCGGTCCAACATGCACTTCAGTTCGTCTAGCGGTCTATCAGCCTTGTCGCCTTCGG
        GACGGGAATCGGTGGATCCCATTGCGGAACTGTTATCGCAGCTTTCCGGCGTGCGGAGGGGCGGACCGCCCACATCTCAG
        CTGCAGCAGCTACAGATGCAGATGCAGTTGGATCGCCAGCAGGTGACGGCATCGCGCCAAATCGATCGGCTGCCAAGGCG
        TGCGCATCCCATAGTCTCAACATCGAACTCGAATGCCGCCATGGCCGAGGTGATCAGCGGCGGAGCGGGCGGCAGTGGAG
        GCAGTGGCGCAGTTGGAAGCGGCAGTGGAGGCGGCAGCGGGGCAACTGCTCCGCCCAACCTGCGCACCACTGAGTGGCCG
        GTGACAGCCAGCTTCTCGACATCGGCCAGCAATCATTCGCAAACTCAGTCGAGTCTGGCCGCCAACAGCCTCAATGCCAG
        AGAAGCGATCGGAACGAGCAGCAGTGCAGGCAGCAATGTCCTGGGCATCAGCGTGGGCGTCGGCGGAACGGCCAACGGCA
        ACGGTGGAGCAGGTTCATCCGGTGTGGCAACTGGAGCCGGAGGAGCTGGACAGGGAGGAGGCCAGGGTGGTGCGGCAGCT
        GGCGAGTCATTCTTGTTGGCCCAATTCATGCAGCCCACCTTTACCGAGGCCGAGTGGGCGGTCGTGGAGAGTATGCGAGC
        AGATCGCTCCATGTTTGTGCAGTCGCTGATGCTATCGATGCTCTGCACTGAGGCACTGGATTTGAATGCCTCCGACGAGA
        GCCTGGCCAAGAGTGATAATGTAAATAAGGGGCAACAGCAGCAGCAAGAGGATGCCGAGGCCGAGGCGCAAGCGGAAACG
        CTGTTGAACAACAATGCAGATGTGGAGCAGCAGCAGCAGCAGCAACAGCTACAGCCGGCGATGGTGCGACAGGTGAATCA
        AATGCAACAAACCTCGCCAGAGGACTTTGTGTGCGACGAGTATCGCTATAAAAACAAAAAGGCCAACACAACACAAACGA
        GCGGTACTGGCGGATTGGGGGGAGCTGGAGCAACTGCAGCCCCTGGTGGTGGTGCTAGTGGAGCTGGCACTAAGCCAACA
        GCTGATAGAGGCATCGAGAGGCGCAGCGGACGTCCGCCGCCAGGAGAGATGGCCACGGGCTCGCAGCAGCCACAACAGCA
        GCAGCAGTCCACGGCTAATCCGGCAGCGTCTCAGCAAAAATACAAACAGAACGCTAGTGCAGCGACGGCGGCGGGAAACA
        CAAATCAAATTCCCGACACTAGGTAGTGCCTCTGATGATGATGATCACCACAAATTGCATCAACAACAACAGTAACAGCA
        ACCACACCCAATGTAGCTGCAGCAGCCACAAGAAATCTGTCACCACCACTAAACACCGCAACAGCAAGGGAAGCAGAAAG
        CGAAACAGATGGAACTAAAACCAACACAGCCGTTAAAGTAACAACCGGAGTGGGGGATAGCTGCTGCTCTGGAGGAATCC
        GAATCGTCTTAAGCAGTTGCCGACGCAACCGCCGCAGCAATGTCGTCGAAAGGAAAACTATATTATGTATCGTTTATTAA
        ATATATTAAAATTTATATAATTATAAAAAGATGAGGAAGATGTGCAGCAAGAAAAATTATTGTAATCATTGAATTAATTA
        TAATTTAAAGAAACCAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0300743
        2394
        FBtr0300744
        2481
        FBtr0300746
        2488
        FBtr0300747
        2445
        FBtr0300748
        2545
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289969
        599
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0289967
        599
        FBpp0289968
        599
        FBpp0289970
        599
        FBpp0289971
        599
        FBpp0289972
        599
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Unconventional splice site postulated (AT-AC).

        transcript_exception: rare splice-site pair, AT-AC intron

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11984-RF
        Kcmf1-RF
        Secondary FlyBase IDs
          References (0)