Open Close
General Information
Symbol
Dmel\CG1674-RF
Species
D. melanogaster
Annotation Symbol
CG1674-RF
FlyBase ID
FBtr0300797
Feature type
Associated gene
Evidence Rank
Length (nt)
2899
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TAATAATAATAATGCAGGACCTGCCTACCTGTTGAGACGATACAAATATAAATTCCTTTCTCTACATTTTATTATTATTT
          TATAGATTTGTACAGCTTTTAGATATGGATTCTACTTTAAATATTGAGGAGAAAGAAATTGCTACAAAAAATGAAACCCA
          AATAGATTACGCTGATGAGATTAAAACTACTCCCCAAGATAATGATAATCTCAATGAAAAACTCTTGGTATCTTATATTG
          ACAGTGGTTTTGATAAACCCGTCACTTCAAGAGATAATAAAGATGATGACGATCTAAAAATTGAAGAAAGCGAATCTGAA
          GACTGTAATTCAGAGAAAAAAAATACAACAGATTTGGAAGTAAACCCAGCTGCACTAATTGACAAGCCGTCTTTAGATAT
          TAGCTCATCGGATATGGAGAGAACTGTTGAGATAGAAGACTCCGAATCCAATAACCCTATTATTATAGATGCATCTATTA
          AAACGGACCCATTAATATCTGTGGAAAATTTGTCCACCGTTTCTGAGAATAATTTCGAGTTGGACTTAATAGATGGGAGT
          ACTAATGGTGAAAATTCATCGAATGCGGAAAACGAATCACCTGTTCAAGACACGTCGAACATTCTAATTAAAGGCGAAGA
          TGATAAAGCTATCGAAAATTGCAAATCACAGGATACCACTAAATCTTCGTCGGAAAAAAATGTCAATGACCCAACATCCA
          TTGCATCTGATTTATCGGCCGAAAACACTAAAGCAGACCTTGTTTCGCTAAATGAACCGAATGTCAATGACCAAACATCC
          AGTGCATCTGATTTGACGGCCGAAAACACTAAAGCAGACCATGATTCGCTAAATAAACCTAAGGATTTTAATAACCAAAT
          TCTGAACATTATATCGGATATAGATATAAATATAAAAGCACAGGAAAAAATAACACAGCTTAAAGAACAAGAACTAAAAC
          TCATTCAGAAACAGAATGATCTGGCAAATGAAATCCATAAGCAGCAGATCCTAGCTAAGCAGCTTAGTGCACAAAATCAG
          CTTAAACAAAATGAATGTCAAAGTGGAGAGCTCGACTTACACAGTCAATATCAAAATGAGCGCGGCGGACCCACCTCGAC
          ACTGTATCAGGAAAAAAATATAGCCAGTAAAGAATCCGCTAATGTGTCGAAGACGGTTGATTTGCGAAAAATATTTACAC
          CTGCGACCGATGCTGCTGAAATATTACCGAAAAACCGAAAGCTATATGCCTCGTCTGCATTTTATTCTCCAACACTACAC
          CCTACAGTGGAAGACCAAGTCGAGCTAGCTCGAAGAATTTCACATTCATTAAGCGATATAAGTAATCAAACCTCTAAGGG
          TCAGTCTATGTATGTCAATCGCAAAAAACGCTCAGACAAATGGGTTCATGAAGGTGGATCTCAAGGGAATGATGCTATAA
          ATCCATTTAAAGAAAATTCTGAAACGAAATCCACAATGGAGGTTGCGAAGTTGGAAAAAATACCGCTAAAGCTTATAATG
          AACCCAAACGGAAAAGTTCGTGATTATAATTCGCTAAAAGATTTAATTAACGTTGAAGCTGGCCTTTTATCGCCTGACAA
          TTGCGCTGAACTAATAACTGCACTTCAACTTCATCAAGGACGAGGTGCAGAACTTTTTGCGAAGCGCCGCAGAAAGGCTG
          ATAATTGGGTAGTCGATGAATCCCATTCAGGGACTCAATATCATCCATCTGGTATTCCAGATTTTCAGCAGTATCAACAA
          AGGCCTGTTCTAAGTCCAAACATTTTGCCGGCGTATTCTGATGCTGGAAAGCACCGCGTCCAATTGAATATTCATCAAAA
          TCAGCTAATTGAGAAGTATTCAAAACCAGGACTTCAAGTCGTTCAGTCTCCTTGGAAGGCAGCTTTGCAAACTGGTTCAG
          CGAGCTCAGCCTTTCTAGAGGACACCAAGAGTTTTTCACCGCCTGCCTTAACACCAATTCCGTCTTCCCAAGCTGGTAGT
          AAGGACTGGACGGACGCTAATGAGCCCATGCCTCATGGTTCTTCAAGGCGCAATACAAATGCCGTTGCTTCCTCGCCACG
          ATCAGTCATTGTACCATCGAATCCACAAAGGGATCTTGCATATACACCATGCGTTGCTCAGGGCTGGGGAGGTCGAAGTG
          TAGAACTTCCAAAAGGCTTATACGTTCCGAAAGAAATATCTCTCTCAAGTTATGCAGCACCTTCACAGCAGTGCGAAATT
          CACTCGAAACATTTTGAAAGGCCATACGAAGACACTTTTCCGCGCACGTTTCCAAGGAACAACTACTCAGCTAATAATAA
          TTTTCCTGGAAATGATGGTATAGGTGAATTTCCTTTATCAAAGCCAACTGGGTTGACCACTGGAACACTACATCAACAGC
          CCTACTCACCGACTAGCTATAAAAAAACAGTACCTGGGCTCGAAAAAGTTGAGAATTTTGCTAGGTATGAACAGCCTGAT
          AGGAAAAGATTGACGAGTGGAAGTCCACAGTACCTAAACGCGCTACAAAACTCTCAAGTACGCAACGCATCGCCAATACC
          TTTTGGAACTTCATTAAATGAACAGACTTCCTGGCCTCCAAGATCTGTGCTGCTACAGGGAGGCTCTCCCTCTCCGCTGC
          CAAACCACGTGCAAACCTTTAACAAATGTGCCAAGGGTTGGGGATCCATACCAGTCAAGCAACAGTCCTATTCAAGCCAA
          TACAACTTACCTGGAAATCTACCGTACTCTGATTTTTAGGTTGCTTTAGCAATTAAGCGATTTACGACATATGCCAACTA
          CTTACACGATTATAAAATATATTTAATGTGTTTGTTTATTTGCCTTTGAAAATTATAATAGTACTACATCGAAAAATATA
          TGCAATTGTTTCACCTGCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089116
          2557
          FBtr0089119
          1457
          FBtr0300796
          2989
          FBtr0300798
          3016
          FBtr0300799
          2131
          FBtr0300800
          2419
          FBtr0308086
          2917
          FBtr0308087
          3052
          FBtr0333671
          2893
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0290021
          884
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088185
          743
          FBpp0088188
          264
          FBpp0290020
          884
          FBpp0290022
          884
          FBpp0290023
          589
          FBpp0290024
          694
          FBpp0300429
          860
          FBpp0300430
          905
          FBpp0305827
          843
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG1674-RF
          Secondary FlyBase IDs
            References (0)