Open Close
General Information
Symbol
Dmel\CG1674-RH
Species
D. melanogaster
Annotation Symbol
CG1674-RH
FlyBase ID
FBtr0300798
Feature type
Associated gene
Evidence Rank
Length (nt)
3016
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 50 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GACAGTGTGGAAGCTATCTTTGATGTGCAATCATATTCTTAAAGGCAGGCGCATGAATTCATGTTCATTCTATTGGCCTA
        TACGGATTTTAGTTGTATTATTATCTTTCAATAATTCGATACTACAGTATTGTTTGCAGTAAATATTTTTTTAAACAAAT
        AACATTGGGAAATAGGCAAGTGAAAAGATATATTTGATATATATTTGTACAGCTTTTAGATATGGATTCTACTTTAAATA
        TTGAGGAGAAAGAAATTGCTACAAAAAATGAAACCCAAATAGATTACGCTGATGAGATTAAAACTACTCCCCAAGATAAT
        GATAATCTCAATGAAAAACTCTTGGTATCTTATATTGACAGTGGTTTTGATAAACCCGTCACTTCAAGAGATAATAAAGA
        TGATGACGATCTAAAAATTGAAGAAAGCGAATCTGAAGACTGTAATTCAGAGAAAAAAAATACAACAGATTTGGAAGTAA
        ACCCAGCTGCACTAATTGACAAGCCGTCTTTAGATATTAGCTCATCGGATATGGAGAGAACTGTTGAGATAGAAGACTCC
        GAATCCAATAACCCTATTATTATAGATGCATCTATTAAAACGGACCCATTAATATCTGTGGAAAATTTGTCCACCGTTTC
        TGAGAATAATTTCGAGTTGGACTTAATAGATGGGAGTACTAATGGTGAAAATTCATCGAATGCGGAAAACGAATCACCTG
        TTCAAGACACGTCGAACATTCTAATTAAAGGCGAAGATGATAAAGCTATCGAAAATTGCAAATCACAGGATACCACTAAA
        TCTTCGTCGGAAAAAAATGTCAATGACCCAACATCCATTGCATCTGATTTATCGGCCGAAAACACTAAAGCAGACCTTGT
        TTCGCTAAATGAACCGAATGTCAATGACCAAACATCCAGTGCATCTGATTTGACGGCCGAAAACACTAAAGCAGACCATG
        ATTCGCTAAATAAACCTAAGGATTTTAATAACCAAATTCTGAACATTATATCGGATATAGATATAAATATAAAAGCACAG
        GAAAAAATAACACAGCTTAAAGAACAAGAACTAAAACTCATTCAGAAACAGAATGATCTGGCAAATGAAATCCATAAGCA
        GCAGATCCTAGCTAAGCAGCTTAGTGCACAAAATCAGCTTAAACAAAATGAATGTCAAAGTGGAGAGCTCGACTTACACA
        GTCAATATCAAAATGAGCGCGGCGGACCCACCTCGACACTGTATCAGGAAAAAAATATAGCCAGTAAAGAATCCGCTAAT
        GTGTCGAAGACGGTTGATTTGCGAAAAATATTTACACCTGCGACCGATGCTGCTGAAATATTACCGAAAAACCGAAAGCT
        ATATGCCTCGTCTGCATTTTATTCTCCAACACTACACCCTACAGTGGAAGACCAAGTCGAGCTAGCTCGAAGAATTTCAC
        ATTCATTAAGCGATATAAGTAATCAAACCTCTAAGGGTCAGTCTATGTATGTCAATCGCAAAAAACGCTCAGACAAATGG
        GTTCATGAAGGTGGATCTCAAGGGAATGATGCTATAAATCCATTTAAAGAAAATTCTGAAACGAAATCCACAATGGAGGT
        TGCGAAGTTGGAAAAAATACCGCTAAAGCTTATAATGAACCCAAACGGAAAAGTTCGTGATTATAATTCGCTAAAAGATT
        TAATTAACGTTGAAGCTGGCCTTTTATCGCCTGACAATTGCGCTGAACTAATAACTGCACTTCAACTTCATCAAGGACGA
        GGTGCAGAACTTTTTGCGAAGCGCCGCAGAAAGGCTGATAATTGGGTAGTCGATGAATCCCATTCAGGGACTCAATATCA
        TCCATCTGGTATTCCAGATTTTCAGCAGTATCAACAAAGGCCTGTTCTAAGTCCAAACATTTTGCCGGCGTATTCTGATG
        CTGGAAAGCACCGCGTCCAATTGAATATTCATCAAAATCAGCTAATTGAGAAGTATTCAAAACCAGGACTTCAAGTCGTT
        CAGTCTCCTTGGAAGGCAGCTTTGCAAACTGGTTCAGCGAGCTCAGCCTTTCTAGAGGACACCAAGAGTTTTTCACCGCC
        TGCCTTAACACCAATTCCGTCTTCCCAAGCTGGTAGTAAGGACTGGACGGACGCTAATGAGCCCATGCCTCATGGTTCTT
        CAAGGCGCAATACAAATGCCGTTGCTTCCTCGCCACGATCAGTCATTGTACCATCGAATCCACAAAGGGATCTTGCATAT
        ACACCATGCGTTGCTCAGGGCTGGGGAGGTCGAAGTGTAGAACTTCCAAAAGGCTTATACGTTCCGAAAGAAATATCTCT
        CTCAAGTTATGCAGCACCTTCACAGCAGTGCGAAATTCACTCGAAACATTTTGAAAGGCCATACGAAGACACTTTTCCGC
        GCACGTTTCCAAGGAACAACTACTCAGCTAATAATAATTTTCCTGGAAATGATGGTATAGGTGAATTTCCTTTATCAAAG
        CCAACTGGGTTGACCACTGGAACACTACATCAACAGCCCTACTCACCGACTAGCTATAAAAAAACAGTACCTGGGCTCGA
        AAAAGTTGAGAATTTTGCTAGGTATGAACAGCCTGATAGGAAAAGATTGACGAGTGGAAGTCCACAGTACCTAAACGCGC
        TACAAAACTCTCAAGTACGCAACGCATCGCCAATACCTTTTGGAACTTCATTAAATGAACAGACTTCCTGGCCTCCAAGA
        TCTGTGCTGCTACAGGGAGGCTCTCCCTCTCCGCTGCCAAACCACGTGCAAACCTTTAACAAATGTGCCAAGGGTTGGGG
        ATCCATACCAGTCAAGCAACAGTCCTATTCAAGCCAATACAACTTACCTGGAAATCTACCGTACTCTGATTTTTAGGTTG
        CTTTAGCAATTAAGCGATTTACGACATATGCCAACTACTTACACGATTATAAAATATATTTAATGTGTTTGTTTATTTGC
        CTTTGAAAATTATAATAGTACTACATCGAAAAATATATGCAATTGTTTCACCTGCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089116
        2557
        FBtr0089119
        1457
        FBtr0300796
        2989
        FBtr0300797
        2899
        FBtr0300799
        2131
        FBtr0300800
        2419
        FBtr0308086
        2917
        FBtr0308087
        3052
        FBtr0333671
        2893
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290022
        884
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088185
        743
        FBpp0088188
        264
        FBpp0290020
        884
        FBpp0290021
        884
        FBpp0290023
        589
        FBpp0290024
        694
        FBpp0300429
        860
        FBpp0300430
        905
        FBpp0305827
        843
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG1674-RH
        Secondary FlyBase IDs
          References (0)