Open Close
General Information
Symbol
Dmel\CG1620-RB
Species
D. melanogaster
Annotation Symbol
CG1620-RB
FlyBase ID
FBtr0300830
Feature type
Associated gene
Evidence Rank
Length (nt)
2272
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 34 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTTAGTGCCGTTTTTTAGCGCATTTGCGCAGGCGAAGTGCAGATATTTTGGCGCTCTGGCTGCTGCCACACTGTGTGTA
      CGGAAAATGATGGAGTTCGGGAAATCGTCGGATCACTCCCAGCACAGCGCTTCCGAGGCGTCGGCGGACTCCGGCAGCCT
      GGCAAACAGCGATCTGGCCGTCACGCCCACCAAGCGGGAGCGCCGCAAGTCGCCGGCCACCAGTTCGGACAACAACAGCA
      CCAGCGTCCAACCGCCAATGTCGCCGTCGTCCTCGGTGGCGGACACCACCTTTGAGCCCACCATCGACATGATGGTCAAC
      GACTTTGACGACGAGGCCACGCTGAACGAGGAGGAGGCTCTGGCGGACATGGAGGCGCACAGTGCCGAGGACGAGATCGC
      CACGCTGCGCGAGGAGAGCGAGATGCCCATCGAGGAGCTGCTGGCCAAATATGGCGGGACAGCGGCTTCGCCGGCAATGA
      GCAGCTCGAACCGTTCCGGCAGCAGTTCACGACGTGCACGTAGGGCCACAAAGCGCCAGTACCAGGAACTGGACACGGAG
      ATGGCTCACACGTCGACCTCCACTTCGAGCAGCACATCGCAACTGGAGAAACACGACGGCATAGACCAGGAGGAGGAACC
      CAAGGAGGAGGCCGATAAGCTAGCATCACCCCCAGAATCAGGAGAAGCTTCGTCCGTGGACACGGAGGATGCGCAAAAGT
      ATGAGGGGATCAAGAAGCAGCATCGCTCACATTTGCTGGACCTGTATCCAGATGAATCCTTCGTCGATCTGGCGCCCACA
      TGCGGAGAGGAGACGGAAAGATTCACTCCACTGCAAACACTGTTCGATGAAGTGGAGGCCGAGGAGGAGGAGGAAAGCGA
      ATCCGAGTTGGACGATGCTCGGAAGATAATAATGGTGGGTCACGACTATCAGGCTGAGATCCCAGAGGGGCTGTCGCAAT
      ATGGCGATATATTGCCATATGAGAACGAGGATCAGTTGATCTGGGAGCCCAGCCAAGTCAGCGAGCGCGAGGTGGAGGAA
      TATCTGGCCAAGATACAGGAAACCCGATCGATAGTTCCGCCGGATGACGGGTCAGAGACTACGGCGGGCGAGGAAGGCGC
      AGCTACAGGTGCTACTATCGAACCGCCGGCTCCCATTACAGCTCCAGCCACGCCTCCGAGGGCTCCGCTTGCGACAAGTG
      GCGCTGGCGATCAGGAGCTGGTGGTAAAGGATAATGAGCAGGCGCTCCATCTGCTTGTCCAGTGCGGTTACGACTTCAAA
      GAAGCCCTACGACGCAAGCGCATGAACGTCCTGCCTCTCACTGATACCATGAGCAGCTGGTCCGAGGACGAGTGCCTAAA
      GTTCGAGGAGGGCATTCAGCGGTTTGGCAAGGACTTCTATCAGATACGTCAAAACCAGGTAAAGGAGCGTCCATTGCCTG
      CGGACCGCCCTAGCAAGTAATCTATGGGCTCGTTGGGCTCTTTCAGGTGCGCACTAGAACCATGCGCGAGCTGGTCCATT
      TCTACTATCTGTGGAAGAAGAGTGAGCGCCGGGATCAGAGCTTTGCTTTAAACGACACCATCGATCACATGGATGTTTTC
      ATCAACGAGGCGGGCGGTGGCAACGGAAGTGGTAATGGAAATGGTGCCGGGATCGTATCGGGCACCGCTAACAGTAATGG
      TAGCTGCTCACCGCATAGCAGCAATGGTCACAGCAATGGGGATTTGTCTGCCCTGGAGAAGGATACCATCGCCAGTCCTC
      GAAAACCCGCCTCTAAGAGCTATTCTATTATGACCGGGAGTCAGGCGGTAGGTAATCCTTCCGGGGGGAACCGAAAGCGA
      TGCTCATCCGCATCTCTGCCCCTGGAGGACGAGGACAACAACGTCGAGGAAGAACCCAGCCTGTCCACAGTGTAAACGAC
      ATCTCTATCACAATCACCATCATCATTATCATAACCGAGCGCAGGCGCTTTCGATTCGGTTGGGCCAGGCGATGTATTTG
      CAGGGCGCTTCATTACCATTACCACTCACTATAAATATGCATACTGTACGTGTAGTATATACCATATGTCTAAACATATA
      TATTCCAGATTCTTAAATCGACATCTCTCATAACCCGTAAAGAATTTCTCTATTGTTAAGTGTGCGATTCGTCTATTTGT
      TACATGTGCGTGTGGATTCCGGAACCAAGTACTTATCGCTTATATATACAATATATTTTCGCTCAATCCTTGAGTTTCGT
      TGAATGTCAATAAATGTAATATGTATATCTGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0088983
      2529
      FBtr0336918
      2204
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290054
      457
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088056
      586
      FBpp0307855
      586
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG1620-RB
      Secondary FlyBase IDs
        References (0)