Open Close
General Information
Symbol
Dmel\Lerp-RD
Species
D. melanogaster
Annotation Symbol
CG31072-RD
FlyBase ID
FBtr0300939
Feature type
Associated gene
Evidence Rank
Length (nt)
3571
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 10 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACTCGCTTGTAAACGTAAAGTAACATTGGTAAGAGCGGGTGTTGTTTTTTGGCCAGGTAATTTAGCCGCATCCGAAAAAG
        AGCCTGCAGGTGACAAAATGCGTTGCAGTTTGCAAAAGGACTGCGCAGCTCCCACGCAGGAAAATTTTCGTCAGATGCGT
        TTCCCAATTGTGATTTCCCTGCTTTTGCTGCTTTTCTGCAGCGGTGAGAGTGTCGCCGCTGACGCAGCCAATCAGCTGAA
        ATTTTCCACCACGGAATGTAAACTCAAGGAGCCCATTTACGGCAGCACCTTCGACTTCAGTGGTCTCCACTCGGATTTGG
        CCCATGTGGTGAAGAGCATGAACATTGGAGGCGACCAATTCGAGTTCAATATATGCGGAAATCTTTCAAGAACCTGCAAT
        GGGGAAAGTAATGTGGCAGCTTGTCTCAAAAGACAGGGAAAGGAGTATATTTTGGGTCGTCAGCACGAGTTGTTCTACAA
        CAATGGAAATATGTTTCTGAAGTACAAAAGCGGCGCAAAATGCGACAATGGCACTGCCGACAAGCCCAACTACCAGCTGC
        ATGTAATGTTCTCCTGCGACTATACTTTGGATGCCCAGCCTATGCACGTAACGCCTTACGCCAACGAAGTGTGTTCTTTT
        TACATCTCATATAGGACGCCTTTGGCATGCCTATCCATTCCCGAGGGTCTACAATCCAATAGTTGCAGAGTGGGCGACAC
        AAAGTCAAATGGAACCTTCGATCTGATGCCGCTGAGTGATAGTAACTATCATACGAGCAATCGTCAAGGCGCCTTCTTTG
        TGATCAATGTCTGTAAGCCGGTGCTTTATGGAGAGAACAGCATGTGTCCGGCAGGCAGTAGCGTTTGTCTATTTGATAGT
        AAAGCCACAAATCCAAAAGAACGATTTATCAATTTCGGCAATGTACAAACGCATCCGGTGGTGGAGAAAGGGCAGCTACT
        GCTCAGGCATGAGTCACCAACGCCATGTGCCAAGAACTCCAGTGCAAACTACACCAGCGTGATTTACTTTAGCTGTGACA
        AGTTCATAAGGAATGCCCATCCGGAGTTCGCGGGTCTGGGAGCCGATTCCTGCACCTATCAGTTCAACTTTGCAACGCCT
        TTGGCCTGTAATGATCTCAAACCGTGCACGGCCTTTACCTCGACAAATGAGCTGTTGGATCTGAGTTCGCTTAGCTCTAA
        GCCAGCTCGCACTTTGCTTAAGGATGGCAAGAACTATACAATTGCTGTGTGCGCACATGCTGGGGCGCCCTGCCAGGAAA
        ATGGCGGCGCTTGTTACGAGCAGAATTCCACGACCATCAGCCTGGGCAACTCCAACTCGCAGCTGCGTTTCAATCAGACC
        GGTTCGCTGTATTTGCTGTACGAGGATGGTGCCGAGTGCTCCACAGCAACGGGCATGCGGCGCTGGTCGACAAAAATCGA
        GTTTGTCTGTGCGAACAATGCGACGAAGGACAATGGAGCCAGCACTGCTGGCGGTAGCGATTCTTTGAAAATAATTGAGG
        ACTCCAATTGTCAGCTGTTGATCCAATATCAGACGCCGCTTGCCTGCCGGGAGCCGATTAGATGCAAGGCAACCACCTAT
        GTGGACCACACAAACGATGGACTGGGCAGCAGCGGCGACGAGCTGATCGACCTAACGCCATTGATTAGCGCCACCGACAA
        CTACGAGGCAAGAGTGGAGCTGCCGGCCAGCATGGAGCACCTGGTGCCCAAGACGACCAAGTTCTTTTTGAATGTGTGCC
        GTCCATTAGTGCCCAAATACCAATTAGGCTGTGCCGGCGGATCTGCTGCCTGCATGGCCAAAGTGACTGCCGCCGGCGCC
        CCCGAGGAGGAGCGTAGCATGGGCTTTCCTCTGGTGTCACTGACGCAACGGAATCGCACCTTCGCCGAGCTGGCTTACTT
        GAAGGGAGACCCCTGTCCCACAGACAACACCTCGGAGCTCTCAACGCACATCCTTTTCAACTGTAATATGCGTGCCGGTC
        GGGGACAGCCCGTGCTACGTTCGGTTGAGGACTGTGCCTATCGGTTCGAGTGGGAGACCAATGTCTTCTGTCCGCCGCAC
        GAGTGCACCTTCAGTGCGGACACCTGCGATCTGGTGCACGACGAGCTGGGTCGTCGTTTCAACTTCAAGAGTGCGCCGTT
        CACCAAGGATGGCAAGATTGAGATTGACTACAACGCCACGAAGATGTCGGTAAACATTTGCGGAGCGCATCGCAAGGCAA
        TGACGGACTATTCGCAGGCGCTGGTCAACATATTCTTCACACACGAGTCGCCTAATTGCGGTCGGGAAGGCACAATGAAC
        GTCCAGATCCGGCTGATATGCAGCGACCAGACCGAGAGCAGCAGTACCATCTCGAGCGACCAGCAATGCAATTTGCTTTA
        TGTGCAACGAACGCCGAGCATCTGCGAGTTCCTTTCCCTCGGCGCAACGCAGCAGAATTTTGAAAGCAATGGCTCCACGA
        GCAGTAGCACCAGCAGCAGCAGCACATCCACCACCACCAGCACGACTACCCAGGCATCGCCAGCGGGTAAGCCAACTAAG
        GCGGCCACGTCGACAACGACAACAACAGTTGGTCCCGATCCGGCGGCTACTCCCATTGGGCCAACGGCGTCCGTGGGCAC
        CATCCTGGGGGCCATTCTCTCGGTGACCTTCTGCGTGACGTGCCTGGGCCTGTTGGCCTTTTCGCCGGCACGAAGGCAGC
        GCATCCGCCGCCTCTTCCGGCGCAGCAACTCCGCGGTGCGATACTCCCGGGTGCAATCCAATGAGGAGGCCAACCTGCTA
        TTGGAACCCAATGGGGAGTTCACCGAAAGCGATGACGACATGCTGCTTTAGGTGGGCCCAATCTAAGCCAAGTCGTCGTG
        GGACGCCTTCTTTGCCATTAGGATGATGAGGCTGATGGGGGACAGATGGTGGTGGGAAGGAGCGGGGGTAGCTAGTTAAA
        GTCGCGAGAGATCCCAATGTGAGTAACATAGGACACCAAAGAAGACATTACTGAAAACTGGAACTGATTGTGAGCTAAAC
        AAACCAATTGAAAACTAAAGAAAACCGTAGTAGACAAGTAGCGATAAGAGGGGGGCGAACTGCTGATATAAACTGTACAA
        TACGCGTAGGCTACAACGACGACTTACGAAAACCAATTACCGGAACCATACATATATACACATTATATATTTTATATACC
        CTTCGTATGTAAAGGAGAATCCCCAACCTAACCCGTACCTATAGCTATAGTTAAATGCGGCCTGCATTCGCCAGAGAATT
        GCAAAGGACAATTGCTTAAATCGTATTTTCGCTGACGCCAAAATGTATAACCAGTATAGCGCAGCAGCTTTTTCCTTCCA
        TAAAAGATGTGATTTCATTTTTAAAACTTTCAAGTGCAGCTTGTTAGTGGTATTCCTTTGAAACGATTTGTATTTTACTC
        TAAGGCAATCTGTACTTACATTTATGTTTGTGTCTTGAGTTGTTTTTAGTTCAATAAGGCGAGCCACACTTAAAACGGCT
        GAGTGTACAATTTTAAGTGTATACATAATAAAATCTAAAACAATATATACG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085099
        3478
        FBtr0085097
        3457
        FBtr0334310
        3535
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290161
        917
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0099603
        886
        FBpp0084467
        887
        FBpp0306425
        918
        Comments
        Due to an oversight during a gene model update, the symbol for this transcript and its associated polypeptide were not changed to reflect the change in CDS. Although there were no conflicts within a given release, the same symbols were used for different isoforms in different releases. Prior to r5.15 the transcript symbol was Lerp-RC; in r5.15 it was changed to Lerp-RD, a symbol that had not been used previously in the database.
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Lerp-RD
        Secondary FlyBase IDs
          References (0)