Open Close
General Information
Symbol
Dmel\SKIP-RE
Species
D. melanogaster
Annotation Symbol
CG31163-RE
FlyBase ID
FBtr0301028
Feature type
Associated gene
Evidence Rank
Length (nt)
5788
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 65 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GGTCAGTCGTCGAAATGTTCGAGATCCGGTCGTTTTGAAAACCAGCTCGAGCGGTCTATTCGCGTGAAATTGAAACTGAA
      AAAGCCGGTAAAACTGAAGCAAGTGTGTTGTGATTGAGAATTGAGCGAAACGAAAACGGTGGCCAAACGAGCCGTTTAAT
      AAGCAAACAGGCTGGCCAATAACCAATTACCATCAGCCATGCCATCAAGGAATCGTGATAACGCAGACACAACCGGCAGC
      AATTTGTTAATTTGAAACGTCGTGTGTGTTCCTCTACGAAAAAAAAAACCCAGTTATTTAGCAAGCATTTAAATTGCATT
      TGTAGCATAGCACTTTAGTTGCGCGTAGGAGGAACAGCAAGGTCGTTGGGGTCGAATGTGAATGTTTGTGATGCAAGTGA
      CAAAATCAAAATTGGAGTAAATTGGTAGCCATTCCTGTGAGCATTTTCGCGTCGCGTAACGGTAAATCATTGCGCCCTGC
      GTGTCTTCGTGTGCGTGCGTGTTTGAGTGTACGTTTTTCGGTTTTGTTTTCATCTCCTCCTTGCCATCCTCCTTTCTTCC
      ACCTTCAATTGCCATCTCCTAATTTCCTCTACGAACGGAGAAACACGAAAACGAAAAGTTTCGAAGACCAAAATATTGAT
      GAACTATATTTTTGTACTTGACAAATTTTGAATTCAAAACAGACACTAGCGCACAAAAGAACCTGTCATTTAGAACATAA
      GAGGAGCAATGCGGCGAAGCGGTGGCGCCAAACAAAATGTGAGGATAAACCAGCGTTGGAGCCTTCTGGGATTATGCTAA
      AAATGCTCAAAGTGCAATATAAATTTTTATGAGTGTACGCGCTGAATTTTTACGACTGTCTGGGGGCGGGGAAAATAAAT
      TAGAGAAAATGCCACAGGGAGGACGATTTAAAACAATACAATAGCTTAAAGTGGCAAACGGAAATTGCATGCAACCAGGA
      GGCGTGGCACTGTACGCCCCCCGAGCACGTGACGCGCACACCAAGCCAACAGCGAAACTAATATAAGCCATTTTGTAGCG
      CTAATTCGCAGGACACACGTAAACGCAGCACAGCTACGTCTTACGTAAAAACACCACCCATCTGACACTTGGAAATCAAG
      CAGAAACCATACACTCACCTCATCATCATCATCATCAACATGGCCGTTAGCAATATTGTCTGCGAGTGGCTAAGAGCTTT
      GGGCCTGGCCCAATACGCCGAGAGCTTCCTGGACAATGGCTACGACGACCTGGAGATCTGTAAACAGGTCGGTGATCCCG
      ATCTAGATGCCATCGGCGTCGAGAATCCTGCCCATAGACACAAGCTGCTCAAGAGCATCCGATCGCTGAGGGAAAAGGGC
      GCCGCATCCGTTTACTTTATGCTCAACGATCCCAACTCGCTCTCGGGCAGCATGGAGATCCTCTGCGAAACACCACCCAA
      CAACGAACTGGAGCTCGTCCTGCGGGAGCAGCTAGAGACGGACGGAGTCCGGCTGACCGCGCATCCATACTCAACACCGG
      ATGGACAACGCGGCCATTTAGAGGGCCTGGCATCCGTCTATTGCGAATTGCTAATGGCTCCCTTCGGGGACATTTTGGCA
      ACTATCGAGCGGGCGCGCCAGGCGGCCTGGGCGGAGCGGAGTCCGCTGCACAGTGCCGCCCAGGTGGTGGGCGGATCAGG
      TGGGGCTGGCGGCAGCACGGGCAGCGGCAGCGGTGGGGCGGCCAGCGGTGGCAGCGGCGGCAGCAGCGGCGTACTGCACC
      ACCGCCAGCAGCATGGCCATCGTGGCCATTCGATGCACGGCGCCGGTCTGCCCAATAGTCATAGCCAGCCCATTTATGTG
      CCCGGAAAGTACTCGCCCTCGAGTTGTCTGTCCGACAAGGAGGAGGATGAGATTTACGGATTCGGCTATGGCGTCTTCGC
      ACCCCGCGTGGCCAGAGGAGGGTTAACACAACAGCAACAGCTGCTGCAGCAGCAGACGCTGCAAACGCAACAGAGCATAC
      AGCAACAGCAGCAGCAGATGCAACAGCAGCAGCAACAGTTACCAATTGTGCCAGGACAACAGCAGCAAGGACCTCATCAG
      CATCAGACCCTGCCACCGAATGTCGCGCATTTGAACTTTGTGCAGCAAAACTGCCTGAGTCCGCGCTCAGCTTATTTCTA
      CGAATTTCCACCGACAGCTGAGGGCCGCGAGACAAAGAAACGCACCACACTGGCCCGGCTGCTGAAAGGCTTGAAGACTG
      TCAATCGACGGGATCGGAACAATCAACAGAATGGCGCCCAGGCCAGGGCGGCTAACGATCGTCTGCGGCACTTTCAAATG
      ATAAACGGCGGCGCCGGCGGACAGCAGCACAGTTTCGAGGAGACAATCCACAGGTTGAAAGTACAAGAGGCCATGCGGAA
      AAAGGAAAAATTTCAACGTGAACACGAGGAGATCCTGCGTGATATTCGACAGGGACTGTTGCAAATGAGTCGCGGCGAAG
      GACGCATGGACGATACGTATATGTACGACGAGGCGCTGAGAACGGGTGGCGGTATGGGCATCGCCGGACTGGGCATGCCA
      CTCGGTGTGGGCGGCAATGGTGGCGGCGGGGGAGCAGCCCATTATGCGGTGAGTGCGCTGCATCATCAAGGTCATTGGTA
      CGACGAGCCGCCCTACGAAAGCGATCCCGATGACTTTCTTATGGCCGGGCTCAACTGCGGACCAGCTGCCACAATTCAGG
      GTGGCCGTGTGCGCTTCTCGAACAACCGCGAGAGCACAGGCGTAATTTCATTAAGATCCGCCGGAGATATTTCATTGCCG
      CAACGTGGACCGCCGCGTAGAGGTCTTATCGTGCCGCAGCAGCCGCCAAATCCACCGACAATAATACCCTTAACGCACGC
      CAGATCTCATGATCGCGAAAGCGGCGACTACGCGGGCTCCATCTCAGATCTACAAAGCGTTACCTCCAGATTCAGTACGG
      TGTCGATTGGCACCAACAACTGCACGGCCCGCTATCGAACCCTAAGCGGTGGAATTGGGGAATCACCATCGCTGTCGCCC
      AGTCCATCGTCGGATTACGAGGACATCGGAGTGACCAGGGGCCACGGATGTCTACCGCCCAGCCTGCTGGCCGCTAAGGC
      CAAAAAGAACGGACTGCCGCACGGCAAGGCGAACACCATTTGCCAAAAGGCCACGGTGCATCATTCGGGCGAGATGCGTA
      GCTCGGCAAAGGAAATTGGCGCATTTAATGAGAATGGACGAAACTTTGTTGCCACAAAGGATACGTCGAGGGATTTCAGC
      AATTCCCAAGATAATACCGACCGTGGCAGCATGAGCGATCAGGCGTTCGCCTGTTCGGCCAGCTCCGTGGAAAGTTTGCC
      CAGCGCATCCGGTTCGAGCACCCAGGCTCTGGTTCGTCCTGGCAGTCCGCACAGCTCGATTTCGGCCGAGGATCGCACCT
      CGATGGCCAGCTGCATCTGCAAGGCCAAGGCTCTCGTGGATAGTTTGCCCAATCCCTACGATAAGGAGGCACTCAAATTC
      AAGAAGGGCGACCTTATCGATGTGCTGTCGATGAACGCCTCGGGCATTTGGAAGGGTCGATGCCACGGCCGCGTGGGCCA
      CTTCAAGTTCATCAACGTGGAGGTGCTGCCGGAGCAGCGAATGAAGAACTCCAGCAGCAAGACCCTGGCCGCCGGCTCGC
      GTTTGGCTAATTCTGGAAATGGCAGCCACAATGGTGGACCCTGCTCCGTGGAGGACCTGCTAATTCGCATTGGACTCAAG
      GAGTACACCTCCGTCTTTGTGCTCAACGGCTACGAGGACCTGGAACTGTTCAAGGAACTGGAGCCCGCTGACCTGGATTA
      CCTGGGCATTCTCAACCAGGAACATCGTGCCAAGCTGCTGACGGCTGTGCAACTGCTGCATGACATTGAATGCTCCGATG
      TGGATATACCCGGATCCAGCTCGGAAAATGATGAAGCCCGCCTGAACAACATCAATATGAAGCATGGAGCATCGCCCTTT
      GGTCGACGCCACTTTCCCCGCGACTCTGGATGCTACGAGGGATCCCCGCTACCCAGCTCACAGACACCTACCCAGGCGGT
      AAACTCGACGGACGAGTCGAACAGCTTGGACGACGTGGTGACCAAGTGTTCCAGTGAAATTATGAAGCGCGTGGAGAGCG
      CCCGCCGTTGCAAGGACAATCCGTTCAAAACCACTCTGCCCGGCGGAGGACGACTGGGCAAGAAGTCCTTTCTCGGCGGC
      AACGGCCTTATGGCGGACGATACGCTCACGCGTGGAGGGCTTAGCGAGAAGTCGAGCGATTCGGGGGTCAGCAGCAGTTC
      GCTATCGTCGGGTCCGCTGAAGAGCAGCACTTAACATTTGCCCACCATACTGGCCCACGAGTTGCTGCTGGGCGTGGGCT
      CGGGCATGGGCATGGGTCTTGGTCTTGGCACCATGAGTCATGGCACCACAGGTACCCTGACGCCCCACGGAGTGGCCACT
      GCCACCTCGCCTACCGCCCATTCGGCACCGCTGGGTAACATCTGCAACACGCTGCCACATGCACCAAGCTCCTCAGGCGG
      CGGCGGCGTATCTTCCTCCATGGCCAGCAACCTGCCACTCAACCGGAATCTGGTAATGCTGCGCAATCATCTGCGCAAGA
      ATACGGGCGGTAGCATTACCGGAAATGGCGGCGTAGGAGCTTCCGGTGTTGGAGCACAGCTGCTGCAGGATCAGGACGAC
      AGACTGGAGGATCAATAACCCATTTACTACATCAAATTCTTAGTTTAGTCTCCCATTGAGTTAAGTGTATTTCAATTGCT
      GTGATTCGATAGTGAAAACAAAAGGCCAACATGCGTCTTTCAGTTCAAATGTATAGTATGTATAGAGAGAGATAGACAGA
      CAGTTAAGAGAGAGACCGGTATAGTGGGGGATGTGTTTAAAGGAAAGAGAAAGATAGCAAGCAGAGATAGTAAGAGTCAG
      TCAATCCTTCCTCCGATAATGTTGGCATTTACACAAATATTTAACACTTATATAAATACAGACTTTACAGACTTATATAT
      ACATACACAATCTGCAGAAAAGGAGAAATTTTATATACTTAGTGATGTAATGAAAATATTTATATATTTTGACTATATTT
      TGATTTTTAGTTAGTTTGAAGCTATGCATTGAATGAGACTTGTATGATTTGCCATTTTATTACTGTTTAATTGCTTTGTG
      TATGCATATTTCTCAACGTGATATTGTCAAACGTCCAACTTGAATTGCATTTTAAATAGATTCATTTCTAACATTTTAAT
      AAGAGACACACATAGAAGTTGATTCCTATTTTAAGGCACTAATCTGAGTGCAAGCAATAGACCAATTCAATTTTAGCAAC
      CAAGCAAAACAAAATATTTATAAACAAAAATAGAAAACATAAGAAGAAACAGAACACCAACTGCCATTCGAAACTAATTT
      TAATTTGTTAATCTCGTATTAGGACAATGTAAATGGAATGAATGCATCGTGCAAATCCGTCAGAAACTTGTAAAAATTAA
      TGCCGAAAATTGCCAAATCGAGCAAACAAAAGTAATGTACGCTAAGCAATATTTTCAAATCGTAGCGTGTCGTGTCCGGA
      TCGTGTGTACATATATAGGATGATCCAGTTAAGATCTATTATGCCACTTATAGCAGATATCAGATCGTAAACACTATGAG
      CGATTTAGCGTTAATCAAAAGCAGACAATGAAATTAGTCAGGCAGCGCAAATGTTTTTAATCAGTTTTCAGCAATTAGTT
      AAATAAATGAACGAATATTTATCACGGC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0084197
      5049
      FBtr0305036
      6584
      FBtr0305037
      6489
      FBtr0310203
      508
      FBtr0330381
      5049
      FBtr0336712
      6669
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290250
      1064
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0083595
      952
      FBpp0293573
      1064
      FBpp0293574
      1034
      FBpp0301887
      128
      FBpp0303407
      1080
      FBpp0307693
      1027
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG31163-RE
      SKIP-RE
      Secondary FlyBase IDs
        References (0)